EMAIL THIS PAGE TO A FRIEND

UNC80

unc-80 homolog (C. elegans)

Synonyms: C2orf21 UNC-80
Gene ID:
Mouse(329178) unc-80 homolog (C. elegans)
Rat(316460) unc-80 homolog (C. elegans)
cow(536610) unc-80 homolog (C. elegans)
sheep(101122170) unc-80 homolog (C. elegans)
naked mole-rat(101701377) unc-80 homolog (C. elegans)
Domestic Rabbit(100339726) unc-80 homolog (C. elegans)
domestic guinea pig(100722465) unc-80 homolog (C. elegans)
Zebrafish(100536734) unc-80 homolog (C. elegans)
domestic cat(101098246) unc-80 homolog (C. elegans)
Horse(100049923) unc-80 homolog (C. elegans)
dog(488505) unc-80 homolog (C. elegans)
chicken(770543) unc-80 homolog (C. elegans)
148 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182587 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182587 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182587 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182587 Rosetta Predictions human pricing
XM_001053529 Rosetta Predictions rat pricing
XM_237232 Rosetta Predictions rat pricing
XM_893763 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073150 predicted 571
2 SASI_Hs01_00073151 predicted 339
3 SASI_Hs01_00073152 predicted 778
4 SASI_Hs01_00073153 predicted 783
5 SASI_Hs01_00073154 predicted 218
6 SASI_Hs01_00073155 predicted 635
7 SASI_Hs01_00073156 predicted 754
8 SASI_Hs01_00073157 predicted 558
9 SASI_Hs01_00073158 predicted 308
10 SASI_Hs01_00073159 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053529 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272633 predicted 4614
2 SASI_Rn02_00272634 predicted 2793
3 SASI_Rn02_00272635 predicted 5895
4 SASI_Rn02_00272636 predicted 4105
5 SASI_Rn02_00272637 predicted 3112
6 SASI_Rn02_00272638 predicted 7989
7 SASI_Rn02_00272639 predicted 3474
8 SASI_Rn02_00272640 predicted 2452
9 SASI_Rn02_00272641 predicted 1440
10 SASI_Rn02_00272642 predicted 2603
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237232 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00137545 predicted 4755
2 SASI_Rn01_00137546 predicted 6330
3 SASI_Rn01_00137547 predicted 6926
4 SASI_Rn01_00137548 predicted 4235
5 SASI_Rn01_00137549 predicted 3253
6 SASI_Rn01_00137550 predicted 8336
7 SASI_Rn01_00137551 predicted 3613
8 SASI_Rn01_00137552 predicted 2456
9 SASI_Rn01_00137553 predicted 7243
10 SASI_Rn01_00137554 predicted 1451
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_893763 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240998 predicted 3121
2 SASI_Mm01_00240999 predicted 1951
3 SASI_Mm01_00241000 predicted 3874
4 SASI_Mm01_00241001 predicted 4717
5 SASI_Mm01_00241002 predicted 8805
6 SASI_Mm01_00241003 predicted 4700
7 SASI_Mm01_00241004 predicted 5858
8 SASI_Mm01_00241005 predicted 8043
9 SASI_Mm01_00241006 predicted 8749
10 SASI_Mm01_00241007 predicted 3730
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182587
UNC80 MISSION shRNA Bacterial Glycerol Stock
unc-80 homolog (C. elegans)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182587.1-814s1c1
Sequence:CCGGGTTCTCCTATCAACAGTCAAACTCGAGTTTGACTGTTGATAGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182587.1-1455s1c1
Sequence:CCGGCCTAGAGATTTGTGGAACTTTCTCGAGAAAGTTCCACAAATCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182587.1-894s1c1
Sequence:CCGGCGTGAAACATTCCAGTCTGATCTCGAGATCAGACTGGAATGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182587.1-353s1c1
Sequence:CCGGCCTGCTTTCAAACCGAAACAACTCGAGTTGTTTCGGTTTGAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182587.1-2385s1c1
Sequence:CCGGCCTGGAGTTAAAGAAGATCATCTCGAGATGATCTTCTTTAACTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182587.3-5723s21c1
Sequence:CCGGATCAACGGTTCTTCGACATTTCTCGAGAAATGTCGAAGAACCGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182587.3-6106s21c1
Sequence:CCGGTCCATGAAGACACTCAATTTGCTCGAGCAAATTGAGTGTCTTCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182587
UNC80 MISSION shRNA shRNA Plasmid DNA
unc-80 homolog (C. elegans)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182587.1-814s1c1
Sequence:CCGGGTTCTCCTATCAACAGTCAAACTCGAGTTTGACTGTTGATAGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182587.1-1455s1c1
Sequence:CCGGCCTAGAGATTTGTGGAACTTTCTCGAGAAAGTTCCACAAATCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182587.1-894s1c1
Sequence:CCGGCGTGAAACATTCCAGTCTGATCTCGAGATCAGACTGGAATGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182587.1-353s1c1
Sequence:CCGGCCTGCTTTCAAACCGAAACAACTCGAGTTGTTTCGGTTTGAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182587.1-2385s1c1
Sequence:CCGGCCTGGAGTTAAAGAAGATCATCTCGAGATGATCTTCTTTAACTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182587.3-5723s21c1
Sequence:CCGGATCAACGGTTCTTCGACATTTCTCGAGAAATGTCGAAGAACCGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182587.3-6106s21c1
Sequence:CCGGTCCATGAAGACACTCAATTTGCTCGAGCAAATTGAGTGTCTTCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182587
UNC80 MISSION shRNA Lentiviral Transduction Particles
unc-80 homolog (C. elegans)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182587.1-814s1c1
Sequence:CCGGGTTCTCCTATCAACAGTCAAACTCGAGTTTGACTGTTGATAGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182587.1-1455s1c1
Sequence:CCGGCCTAGAGATTTGTGGAACTTTCTCGAGAAAGTTCCACAAATCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182587.1-894s1c1
Sequence:CCGGCGTGAAACATTCCAGTCTGATCTCGAGATCAGACTGGAATGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182587.1-353s1c1
Sequence:CCGGCCTGCTTTCAAACCGAAACAACTCGAGTTGTTTCGGTTTGAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182587.1-2385s1c1
Sequence:CCGGCCTGGAGTTAAAGAAGATCATCTCGAGATGATCTTCTTTAACTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182587.3-5723s21c1
Sequence:CCGGATCAACGGTTCTTCGACATTTCTCGAGAAATGTCGAAGAACCGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182587.3-6106s21c1
Sequence:CCGGTCCATGAAGACACTCAATTTGCTCGAGCAAATTGAGTGTCTTCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks