EMAIL THIS PAGE TO A FRIEND

UNC93A

unc-93 homolog A (C. elegans)

Synonyms: Unc-93A dJ366N23.1 dJ366N23.2
UniProtKB ID: Q86WB7, B3KRP5, Q4QQJ4, Q5JZD6
Gene ID:
Mouse(381058) unc-93 homolog A (C. elegans)
Rat(685007) unc-93 homolog A (C. elegans)
Zebrafish(559995) unc-93 homolog A (C. elegans)
chicken(421565) unc-93 homolog A (C. elegans)
Horse(100050109) unc-93 homolog A (C. elegans)
domestic cat(101081141) unc-93 homolog A (C. elegans)
dog(612460) unc-93 homolog A (C. elegans)
domestic guinea pig(100720953) unc-93 homolog A (C. elegans)
naked mole-rat(101705958) unc-93 homolog A (C. elegans)
cow(613535) unc-93 homolog A (C. elegans)
sheep(101115038) unc-93 homolog A (C. elegans)
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018974 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018974 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018974 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199252 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199252 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199252 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018974 Rosetta Predictions human pricing
XM_001061886 Rosetta Predictions rat pricing
NM_199252 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240906 predicted 483
2 SASI_Hs02_00352458 predicted 1090
3 SASI_Hs02_00352459 predicted 456
4 SASI_Hs02_00352460 predicted 1118
5 SASI_Hs02_00352461 predicted 452
6 SASI_Hs02_00352462 predicted 485
7 SASI_Hs02_00352463 predicted 1215
8 SASI_Hs01_00240911 predicted 1546
9 SASI_Hs02_00352464 predicted 470
10 SASI_Hs02_00352465 predicted 1175
11 SASI_Hs01_00240907 predicted 1661
12 SASI_Hs01_00240908 predicted 809
13 SASI_Hs01_00240909 predicted 1576
14 SASI_Hs01_00240910 predicted 817
15 SASI_Hs01_00240912 predicted 1573
16 SASI_Hs01_00240913 predicted 888
17 SASI_Hs01_00240914 predicted 1520
18 SASI_Hs01_00240915 predicted 1227
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301656 predicted 207
2 SASI_Rn02_00301657 predicted 310
3 SASI_Rn02_00301658 predicted 528
4 SASI_Rn02_00301659 predicted 403
5 SASI_Rn02_00301660 predicted 250
6 SASI_Rn02_00301661 predicted 475
7 SASI_Rn02_00301662 predicted 413
8 SASI_Rn02_00301663 predicted 225
9 SASI_Rn02_00301664 predicted 273
10 SASI_Rn02_00301665 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083656 predicted 1553
2 SASI_Mm02_00351415 predicted 1280
3 SASI_Mm01_00083657 predicted 676
4 SASI_Mm01_00083658 predicted 639
5 SASI_Mm01_00083659 predicted 1444
6 SASI_Mm02_00351416 predicted 1165
7 SASI_Mm01_00083660 predicted 806
8 SASI_Mm01_00083661 predicted 1450
9 SASI_Mm01_00083663 predicted 448
10 SASI_Mm02_00351417 predicted 1274
11 SASI_Mm01_00083662 predicted 1575
12 SASI_Mm01_00083664 predicted 782
13 SASI_Mm01_00083665 predicted 1522
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018974
UNC93A MISSION shRNA Bacterial Glycerol Stock
unc-93 homolog A (C. elegans)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018974.3-850s21c1
Sequence:CCGGACGAGATGTTCAGCGGGAAAGCTCGAGCTTTCCCGCTGAACATCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018974.3-936s21c1
Sequence:CCGGATAAACGTCTGTGCCTCTTAACTCGAGTTAAGAGGCACAGACGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018974.2-905s1c1
Sequence:CCGGCGAATACACAAGGTCCTATGTCTCGAGACATAGGACCTTGTGTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018974.2-1718s1c1
Sequence:CCGGGCCAATTAGAATTTGCCTGAACTCGAGTTCAGGCAAATTCTAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018974.2-1119s1c1
Sequence:CCGGGCAGTGTTCTTCGTATTCTCTCTCGAGAGAGAATACGAAGAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018974.2-1416s1c1
Sequence:CCGGCAGGCAGAGGATGAAGAAATACTCGAGTATTTCTTCATCCTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018974.2-1563s1c1
Sequence:CCGGCCATTCTGAAGAGATCATGTTCTCGAGAACATGATCTCTTCAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018974
UNC93A MISSION shRNA shRNA Plasmid DNA
unc-93 homolog A (C. elegans)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018974.3-850s21c1
Sequence:CCGGACGAGATGTTCAGCGGGAAAGCTCGAGCTTTCCCGCTGAACATCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018974.3-936s21c1
Sequence:CCGGATAAACGTCTGTGCCTCTTAACTCGAGTTAAGAGGCACAGACGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018974.2-905s1c1
Sequence:CCGGCGAATACACAAGGTCCTATGTCTCGAGACATAGGACCTTGTGTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018974.2-1718s1c1
Sequence:CCGGGCCAATTAGAATTTGCCTGAACTCGAGTTCAGGCAAATTCTAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018974.2-1119s1c1
Sequence:CCGGGCAGTGTTCTTCGTATTCTCTCTCGAGAGAGAATACGAAGAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018974.2-1416s1c1
Sequence:CCGGCAGGCAGAGGATGAAGAAATACTCGAGTATTTCTTCATCCTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018974.2-1563s1c1
Sequence:CCGGCCATTCTGAAGAGATCATGTTCTCGAGAACATGATCTCTTCAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018974
UNC93A MISSION shRNA Lentiviral Transduction Particles
unc-93 homolog A (C. elegans)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018974.3-850s21c1
Sequence:CCGGACGAGATGTTCAGCGGGAAAGCTCGAGCTTTCCCGCTGAACATCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018974.3-936s21c1
Sequence:CCGGATAAACGTCTGTGCCTCTTAACTCGAGTTAAGAGGCACAGACGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018974.2-905s1c1
Sequence:CCGGCGAATACACAAGGTCCTATGTCTCGAGACATAGGACCTTGTGTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018974.2-1718s1c1
Sequence:CCGGGCCAATTAGAATTTGCCTGAACTCGAGTTCAGGCAAATTCTAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018974.2-1119s1c1
Sequence:CCGGGCAGTGTTCTTCGTATTCTCTCTCGAGAGAGAATACGAAGAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018974.2-1416s1c1
Sequence:CCGGCAGGCAGAGGATGAAGAAATACTCGAGTATTTCTTCATCCTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018974.2-1563s1c1
Sequence:CCGGCCATTCTGAAGAGATCATGTTCTCGAGAACATGATCTCTTCAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199252
UNC93A MISSION shRNA Bacterial Glycerol Stock
unc-93 homolog A (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199252.1-1468s1c1
Sequence:CCGGAGAAGCCATAGGGTTTGTCATCTCGAGATGACAAACCCTATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199252.1-1275s1c1
Sequence:CCGGGAGCAGCCATTCACTTCTCTTCTCGAGAAGAGAAGTGAATGGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199252.1-1513s1c1
Sequence:CCGGGTGTGTGAGTACCAAGCTCTACTCGAGTAGAGCTTGGTACTCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199252.1-1985s1c1
Sequence:CCGGGCTCTGTCATTAAAGCACTTTCTCGAGAAAGTGCTTTAATGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199252.1-1391s1c1
Sequence:CCGGCAGACACAGAACAATGCTCTTCTCGAGAAGAGCATTGTTCTGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199252
UNC93A MISSION shRNA shRNA Plasmid DNA
unc-93 homolog A (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199252.1-1468s1c1
Sequence:CCGGAGAAGCCATAGGGTTTGTCATCTCGAGATGACAAACCCTATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199252.1-1275s1c1
Sequence:CCGGGAGCAGCCATTCACTTCTCTTCTCGAGAAGAGAAGTGAATGGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199252.1-1513s1c1
Sequence:CCGGGTGTGTGAGTACCAAGCTCTACTCGAGTAGAGCTTGGTACTCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199252.1-1985s1c1
Sequence:CCGGGCTCTGTCATTAAAGCACTTTCTCGAGAAAGTGCTTTAATGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199252.1-1391s1c1
Sequence:CCGGCAGACACAGAACAATGCTCTTCTCGAGAAGAGCATTGTTCTGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199252
UNC93A MISSION shRNA Lentiviral Transduction Particles
unc-93 homolog A (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199252.1-1468s1c1
Sequence:CCGGAGAAGCCATAGGGTTTGTCATCTCGAGATGACAAACCCTATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199252.1-1275s1c1
Sequence:CCGGGAGCAGCCATTCACTTCTCTTCTCGAGAAGAGAAGTGAATGGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199252.1-1513s1c1
Sequence:CCGGGTGTGTGAGTACCAAGCTCTACTCGAGTAGAGCTTGGTACTCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199252.1-1985s1c1
Sequence:CCGGGCTCTGTCATTAAAGCACTTTCTCGAGAAAGTGCTTTAATGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199252.1-1391s1c1
Sequence:CCGGCAGACACAGAACAATGCTCTTCTCGAGAAGAGCATTGTTCTGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks