EMAIL THIS PAGE TO A FRIEND

UNC93B1

unc-93 homolog B1 (C. elegans)

Synonyms: IIAE1 UNC93 UNC93B Unc-93B1
UniProtKB ID: Q9H1C4, O95764, Q569H6, Q710D4
Gene ID:
Human(81622) Summary: This gene encodes a protein with similarity to the C. elegans unc93 protein. The Unc93 protein is involved in the regulation or coordination of muscle contraction in the worm. [provided by RefSeq, Jul 2008]
Mouse(54445) unc-93 homolog B1 (C. elegans)
Rat(361689) unc-93 homolog B1 (C. elegans)
cow(508878) unc-93 homolog B1 (C. elegans)
sheep(101112435) unc-93 homolog B1 (C. elegans)
naked mole-rat(101723841) unc-93 homolog B1 (C. elegans)
domestic guinea pig(100726279) unc-93 homolog B1 (C. elegans)
Zebrafish(100000934) unc-93 homolog B1 (C. elegans)
domestic cat(101083453) unc-93 homolog B1 (C. elegans)
chicken(395244) unc-93 homolog B1 (C. elegans)
dog(483692) unc-93 homolog B1 (C. elegans)
Horse(100059773) unc-93 homolog B1 (C. elegans)
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030930 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030930 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030930 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019449 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019449 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019449 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030930 Rosetta Predictions human pricing
NM_001108513 Rosetta Predictions rat pricing
NM_019449 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093819 predicted 527
2 SASI_Hs01_00093820 predicted 607
3 SASI_Hs01_00093821 predicted 1070
4 SASI_Hs01_00093822 predicted 503
5 SASI_Hs01_00093823 predicted 1146
6 SASI_Hs01_00093824 predicted 631
7 SASI_Hs01_00093825 predicted 1084
8 SASI_Hs01_00093826 predicted 924
9 SASI_Hs01_00093827 predicted 873
10 SASI_Hs01_00093828 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239389 predicted 1942
2 SASI_Rn02_00239390 predicted 1926
3 SASI_Rn02_00239391 predicted 932
4 SASI_Rn02_00239392 predicted 1156
5 SASI_Rn02_00239393 predicted 548
6 SASI_Rn02_00239394 predicted 631
7 SASI_Rn02_00239395 predicted 1620
8 SASI_Rn02_00239396 predicted 856
9 SASI_Rn02_00239397 predicted 359
10 SASI_Rn02_00239398 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083035 predicted 750
2 SASI_Mm01_00083036 predicted 817
3 SASI_Mm01_00083037 predicted 571
4 SASI_Mm01_00083038 predicted 1100
5 SASI_Mm01_00083039 predicted 486
6 SASI_Mm01_00083040 predicted 1038
7 SASI_Mm01_00083042 predicted 360
8 SASI_Mm01_00083043 predicted 1373
9 SASI_Mm01_00083044 predicted 298
10 SASI_Mm02_00324437 predicted 431
11 SASI_Mm01_00083041 predicted 1570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030930
VALIDATED
UNC93B1 MISSION shRNA Bacterial Glycerol Stock
unc-93 homolog B1 (C. elegans)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030930.2-740s1c1
Sequence:CCGGCCAAGCCATCTTCTACAGCTTCTCGAGAAGCTGTAGAAGATGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030930.2-521s1c1
Sequence:CCGGCCTCTTTGTCTCCACCAACTACTCGAGTAGTTGGTGGAGACAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030930.2-755s1c1
Sequence:CCGGCAGCTTCTTCCATCTGAGCTTCTCGAGAAGCTCAGATGGAAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030930.2-1114s1c1
Sequence:CCGGCTTTCTTTATCTACAGCGGCTCTCGAGAGCCGCTGTAGATAAAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030930.2-788s1c1
Sequence:CCGGGCTGCCCATGATTTATTTCCTCTCGAGAGGAAATAAATCATGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030930.2-1469s1c1
Sequence:CCGGCAAGGAGAGACAGGACTTCATCTCGAGATGAAGTCCTGTCTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030930
VALIDATED
UNC93B1 MISSION shRNA shRNA Plasmid DNA
unc-93 homolog B1 (C. elegans)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030930.2-740s1c1
Sequence:CCGGCCAAGCCATCTTCTACAGCTTCTCGAGAAGCTGTAGAAGATGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030930.2-521s1c1
Sequence:CCGGCCTCTTTGTCTCCACCAACTACTCGAGTAGTTGGTGGAGACAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030930.2-755s1c1
Sequence:CCGGCAGCTTCTTCCATCTGAGCTTCTCGAGAAGCTCAGATGGAAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030930.2-1114s1c1
Sequence:CCGGCTTTCTTTATCTACAGCGGCTCTCGAGAGCCGCTGTAGATAAAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030930.2-788s1c1
Sequence:CCGGGCTGCCCATGATTTATTTCCTCTCGAGAGGAAATAAATCATGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030930.2-1469s1c1
Sequence:CCGGCAAGGAGAGACAGGACTTCATCTCGAGATGAAGTCCTGTCTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030930
VALIDATED
UNC93B1 MISSION shRNA Lentiviral Transduction Particles
unc-93 homolog B1 (C. elegans)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030930.2-740s1c1
Sequence:CCGGCCAAGCCATCTTCTACAGCTTCTCGAGAAGCTGTAGAAGATGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030930.2-521s1c1
Sequence:CCGGCCTCTTTGTCTCCACCAACTACTCGAGTAGTTGGTGGAGACAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030930.2-755s1c1
Sequence:CCGGCAGCTTCTTCCATCTGAGCTTCTCGAGAAGCTCAGATGGAAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030930.2-1114s1c1
Sequence:CCGGCTTTCTTTATCTACAGCGGCTCTCGAGAGCCGCTGTAGATAAAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030930.2-788s1c1
Sequence:CCGGGCTGCCCATGATTTATTTCCTCTCGAGAGGAAATAAATCATGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030930.2-1469s1c1
Sequence:CCGGCAAGGAGAGACAGGACTTCATCTCGAGATGAAGTCCTGTCTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019449
VALIDATED
UNC93B1 MISSION shRNA Bacterial Glycerol Stock
unc-93 homolog B1 (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019449.1-291s1c1
Sequence:CCGGCAACTGATCCTGCACTATGATCTCGAGATCATAGTGCAGGATCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019449.1-1436s1c1
Sequence:CCGGGCAGGACTTCATCTTCACCATCTCGAGATGGTGAAGATGAAGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019449.1-1073s1c1
Sequence:CCGGCTTCTTTATCTACAGTGGCTTCTCGAGAAGCCACTGTAGATAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019449.1-755s1c1
Sequence:CCGGGATTTACTTCCTCAACAACTACTCGAGTAGTTGTTGAGGAAGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019449.1-746s1c1
Sequence:CCGGGCTGCCCATGATTTACTTCCTCTCGAGAGGAAGTAAATCATGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019449
VALIDATED
UNC93B1 MISSION shRNA shRNA Plasmid DNA
unc-93 homolog B1 (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019449.1-291s1c1
Sequence:CCGGCAACTGATCCTGCACTATGATCTCGAGATCATAGTGCAGGATCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019449.1-1436s1c1
Sequence:CCGGGCAGGACTTCATCTTCACCATCTCGAGATGGTGAAGATGAAGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019449.1-1073s1c1
Sequence:CCGGCTTCTTTATCTACAGTGGCTTCTCGAGAAGCCACTGTAGATAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019449.1-755s1c1
Sequence:CCGGGATTTACTTCCTCAACAACTACTCGAGTAGTTGTTGAGGAAGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019449.1-746s1c1
Sequence:CCGGGCTGCCCATGATTTACTTCCTCTCGAGAGGAAGTAAATCATGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019449
VALIDATED
UNC93B1 MISSION shRNA Lentiviral Transduction Particles
unc-93 homolog B1 (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019449.1-291s1c1
Sequence:CCGGCAACTGATCCTGCACTATGATCTCGAGATCATAGTGCAGGATCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019449.1-1436s1c1
Sequence:CCGGGCAGGACTTCATCTTCACCATCTCGAGATGGTGAAGATGAAGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019449.1-1073s1c1
Sequence:CCGGCTTCTTTATCTACAGTGGCTTCTCGAGAAGCCACTGTAGATAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019449.1-755s1c1
Sequence:CCGGGATTTACTTCCTCAACAACTACTCGAGTAGTTGTTGAGGAAGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019449.1-746s1c1
Sequence:CCGGGCTGCCCATGATTTACTTCCTCTCGAGAGGAAGTAAATCATGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks