EMAIL THIS PAGE TO A FRIEND

UNCX

UNC homeobox

Synonyms: UNCX4.1
UniProtKB ID: A6NJT0, A4D221
Gene ID:
Mouse(22255) UNC homeobox
Rat(29375) UNC homeobox
cow(790191) UNC homeobox
Zebrafish(798510) UNC homeobox
chicken(416458) UNC homeobox
dog(491604) UNC homeobox
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV47546 Anti-UNCX antibody produced in rabbit affinity isolated antibody human, zebrafish
immunohistochemistry, western blot pricing
SAB2102654 Anti-UNCX antibody produced in rabbit affinity isolated antibody rat, bovine, mouse, human, canine,
western blot pricing
HPA063294 Anti-UNCX antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013702 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013702 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013702 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_294209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_294209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_294209 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080461 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080461 Rosetta Predictions human pricing
XM_294209 Rosetta Predictions human pricing
NM_017179 Rosetta Predictions rat pricing
NM_013702 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315056 predicted 254
2 SASI_Hs02_00315057 predicted 377
3 SASI_Hs02_00315058 predicted 372
4 SASI_Hs02_00315059 predicted 477
5 SASI_Hs02_00315060 predicted 404
6 SASI_Hs02_00315061 predicted 310
7 SASI_Hs02_00315062 predicted 385
8 SASI_Hs02_00315063 predicted 358
9 SASI_Hs02_00315064 predicted 252
10 SASI_Hs02_00315065 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_294209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285360 predicted 260
2 SASI_Hs01_00285361 predicted 378
3 SASI_Hs01_00285362 predicted 249
4 SASI_Hs01_00285363 predicted 376
5 SASI_Hs01_00285364 predicted 486
6 SASI_Hs01_00285365 predicted 407
7 SASI_Hs01_00285366 predicted 312
8 SASI_Hs01_00285367 predicted 391
9 SASI_Hs01_00285368 predicted 364
10 SASI_Hs01_00285369 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017179 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111242 predicted 889
2 SASI_Rn01_00111243 predicted 886
3 SASI_Rn01_00111244 predicted 1078
4 SASI_Rn01_00111245 predicted 1363
5 SASI_Rn01_00111246 predicted 876
6 SASI_Rn02_00261512 predicted 1145
7 SASI_Rn01_00111247 predicted 1363
8 SASI_Rn01_00111248 predicted 1080
9 SASI_Rn01_00111250 predicted 878
10 SASI_Rn02_00261513 predicted 1023
11 SASI_Rn01_00111241 predicted 993
12 SASI_Rn01_00111249 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031223 predicted 670
2 SASI_Mm01_00031224 predicted 484
3 SASI_Mm01_00031225 predicted 960
4 SASI_Mm01_00031226 predicted 486
5 SASI_Mm01_00031227 predicted 486
6 SASI_Mm01_00031228 predicted 672
7 SASI_Mm01_00031229 predicted 366
8 SASI_Mm01_00031230 predicted 468
9 SASI_Mm01_00031231 predicted 960
10 SASI_Mm01_00031232 predicted 471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013702
UNCX MISSION shRNA Bacterial Glycerol Stock
UNC homeobox
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013702.2-715s1c1
Sequence:CCGGACACGAGAAGAAACTGCTCAACTCGAGTTGAGCAGTTTCTTCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013702.2-1445s1c1
Sequence:CCGGCCCGCTTCTTTCCGGGACCTACTCGAGTAGGTCCCGGAAAGAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013702.2-399s1c1
Sequence:CCGGCCGGCTGCAAACGGAGACGCACTCGAGTGCGTCTCCGTTTGCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013702.2-1010s1c1
Sequence:CCGGGCGGACAAGGACACGGTCCCTCTCGAGAGGGACCGTGTCCTTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013702.2-661s1c1
Sequence:CCGGCCCAGAGGAGATCGCTCGCAACTCGAGTTGCGAGCGATCTCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013702
UNCX MISSION shRNA shRNA Plasmid DNA
UNC homeobox
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013702.2-715s1c1
Sequence:CCGGACACGAGAAGAAACTGCTCAACTCGAGTTGAGCAGTTTCTTCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013702.2-1445s1c1
Sequence:CCGGCCCGCTTCTTTCCGGGACCTACTCGAGTAGGTCCCGGAAAGAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013702.2-399s1c1
Sequence:CCGGCCGGCTGCAAACGGAGACGCACTCGAGTGCGTCTCCGTTTGCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013702.2-1010s1c1
Sequence:CCGGGCGGACAAGGACACGGTCCCTCTCGAGAGGGACCGTGTCCTTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013702.2-661s1c1
Sequence:CCGGCCCAGAGGAGATCGCTCGCAACTCGAGTTGCGAGCGATCTCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013702
UNCX MISSION shRNA Lentiviral Transduction Particles
UNC homeobox
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013702.2-715s1c1
Sequence:CCGGACACGAGAAGAAACTGCTCAACTCGAGTTGAGCAGTTTCTTCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013702.2-1445s1c1
Sequence:CCGGCCCGCTTCTTTCCGGGACCTACTCGAGTAGGTCCCGGAAAGAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013702.2-399s1c1
Sequence:CCGGCCGGCTGCAAACGGAGACGCACTCGAGTGCGTCTCCGTTTGCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013702.2-1010s1c1
Sequence:CCGGGCGGACAAGGACACGGTCCCTCTCGAGAGGGACCGTGTCCTTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013702.2-661s1c1
Sequence:CCGGCCCAGAGGAGATCGCTCGCAACTCGAGTTGCGAGCGATCTCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_294209
UNCX MISSION shRNA Bacterial Glycerol Stock
UNC homeobox
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294209.4-375s1c1
Sequence:CCGGCCTCGGTATCTCTGCTGGAATCTCGAGATTCCAGCAGAGATACCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294209.4-879s1c1
Sequence:CCGGGAGGAAGAAGGAGAACACGAACTCGAGTTCGTGTTCTCCTTCTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294209.4-51s1c1
Sequence:CCGGCGTCCCTGAAGTGTCCGGCATCTCGAGATGCCGGACACTTCAGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294209.4-410s1c1
Sequence:CCGGCCACAGGAAGAGAACTCCGTTCTCGAGAACGGAGTTCTCTTCCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294209.4-766s1c1
Sequence:CCGGGCGTTCAACGAGAGCCACTATCTCGAGATAGTGGCTCTCGTTGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_294209
UNCX MISSION shRNA shRNA Plasmid DNA
UNC homeobox
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294209.4-375s1c1
Sequence:CCGGCCTCGGTATCTCTGCTGGAATCTCGAGATTCCAGCAGAGATACCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294209.4-879s1c1
Sequence:CCGGGAGGAAGAAGGAGAACACGAACTCGAGTTCGTGTTCTCCTTCTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294209.4-51s1c1
Sequence:CCGGCGTCCCTGAAGTGTCCGGCATCTCGAGATGCCGGACACTTCAGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294209.4-410s1c1
Sequence:CCGGCCACAGGAAGAGAACTCCGTTCTCGAGAACGGAGTTCTCTTCCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294209.4-766s1c1
Sequence:CCGGGCGTTCAACGAGAGCCACTATCTCGAGATAGTGGCTCTCGTTGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_294209
UNCX MISSION shRNA Lentiviral Transduction Particles
UNC homeobox
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294209.4-375s1c1
Sequence:CCGGCCTCGGTATCTCTGCTGGAATCTCGAGATTCCAGCAGAGATACCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294209.4-879s1c1
Sequence:CCGGGAGGAAGAAGGAGAACACGAACTCGAGTTCGTGTTCTCCTTCTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294209.4-51s1c1
Sequence:CCGGCGTCCCTGAAGTGTCCGGCATCTCGAGATGCCGGACACTTCAGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294209.4-410s1c1
Sequence:CCGGCCACAGGAAGAGAACTCCGTTCTCGAGAACGGAGTTCTCTTCCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294209.4-766s1c1
Sequence:CCGGGCGTTCAACGAGAGCCACTATCTCGAGATAGTGGCTCTCGTTGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080461
UNCX MISSION shRNA Bacterial Glycerol Stock
UNC homeobox
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000446331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080461.1-587s21c1
Sequence:CCGGAGCTGGAGAAGATGGAGAAGACTCGAGTCTTCTCCATCTTCTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080461.1-257s21c1
Sequence:CCGGAGCCCTTCAAGCTGTCAGACTCTCGAGAGTCTGACAGCTTGAAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080461.1-443s21c1
Sequence:CCGGGAGTTCAGGTCTGGTTCCAAACTCGAGTTTGGAACCAGACCTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080461
UNCX MISSION shRNA shRNA Plasmid DNA
UNC homeobox
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000446331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080461.1-587s21c1
Sequence:CCGGAGCTGGAGAAGATGGAGAAGACTCGAGTCTTCTCCATCTTCTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080461.1-257s21c1
Sequence:CCGGAGCCCTTCAAGCTGTCAGACTCTCGAGAGTCTGACAGCTTGAAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080461.1-443s21c1
Sequence:CCGGGAGTTCAGGTCTGGTTCCAAACTCGAGTTTGGAACCAGACCTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080461
UNCX MISSION shRNA Lentiviral Transduction Particles
UNC homeobox
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000446331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080461.1-587s21c1
Sequence:CCGGAGCTGGAGAAGATGGAGAAGACTCGAGTCTTCTCCATCTTCTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080461.1-257s21c1
Sequence:CCGGAGCCCTTCAAGCTGTCAGACTCTCGAGAGTCTGACAGCTTGAAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080461.1-443s21c1
Sequence:CCGGGAGTTCAGGTCTGGTTCCAAACTCGAGTTTGGAACCAGACCTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks