EMAIL THIS PAGE TO A FRIEND

UNG

uracil-DNA glycosylase

Synonyms: DGU HIGM4 HIGM5 UDG UNG1 UNG15 UNG2
UniProtKB ID: P13051, A8K5M6, B2R8Y1, O00637, O00719, Q93028
Gene ID:
Human(7374) Summary: This gene encodes one of several uracil-DNA glycosylases. One important function of uracil-DNA glycosylases is to prevent mutagenesis by eliminating uracil from DNA molecules by cleaving the N-glycosylic bond and initiating the base-excision repair (BER) pathway. Uracil bases occur from cytosine deamination or misincorporation of dUMP residues. Alternative promoter usage and splicing of this gene leads to two different isoforms: the mitochondrial UNG1 and the nuclear UNG2. The UNG2 term was used as a previous symbol for the CCNO gene (GeneID 10309), which has been confused with this gene, in the literature and some databases. [provided by RefSeq, Nov 2010]
Mouse(22256) uracil DNA glycosylase
Rat(304577) uracil-DNA glycosylase
fruit fly(44538) uniungula
chicken(374010) uracil-DNA glycosylase
domestic cat(101094053) uracil-DNA glycosylase
dog(486315) uracil-DNA glycosylase
Thale Cress(821394) uracil dna glycosylase
domestic guinea pig(100730581) uracil-DNA glycosylase
naked mole-rat(101717051) uracil-DNA glycosylase
cow(511381) uracil-DNA glycosylase
sheep(101115316) uracil-DNA glycosylase
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003362 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011677 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011677 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011677 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082251 MISSION® esiRNA esiRNA human UNG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003362 Rosetta Predictions human pricing
NM_080911 Rosetta Predictions human pricing
NM_001013124 Rosetta Predictions rat pricing
NM_001040691 Rosetta Predictions mouse pricing
NM_011677 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080074 predicted 629
2 SASI_Hs01_00080075 predicted 1088
3 SASI_Hs01_00080076 predicted 703
4 SASI_Hs01_00080077 predicted 860
5 SASI_Hs01_00080079 predicted 1070
6 SASI_Hs01_00080081 predicted 816
7 SASI_Hs01_00080082 predicted 555
8 SASI_Hs01_00080083 predicted 907
9 SASI_Hs02_00335512 predicted 801
10 SASI_Hs02_00335513 predicted 688
11 SASI_Hs01_00080078 predicted 472
12 SASI_Hs01_00080080 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176020 predicted 594
2 SASI_Hs01_00176021 predicted 1058
3 SASI_Hs01_00176022 predicted 677
4 SASI_Hs01_00176023 predicted 826
5 SASI_Hs01_00176025 predicted 1037
6 SASI_Hs01_00176027 predicted 783
7 SASI_Hs01_00176028 predicted 524
8 SASI_Hs01_00176029 predicted 879
9 SASI_Hs02_00362681 predicted 776
10 SASI_Hs02_00362682 predicted 658
11 SASI_Hs01_00176024 predicted 440
12 SASI_Hs01_00176026 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099814 predicted 1083
2 SASI_Rn01_00099815 predicted 1164
3 SASI_Rn01_00099816 predicted 681
4 SASI_Rn01_00099817 predicted 1114
5 SASI_Rn01_00099819 predicted 1298
6 SASI_Rn01_00099820 predicted 576
7 SASI_Rn01_00099822 predicted 481
8 SASI_Rn01_00099823 predicted 1397
9 SASI_Rn02_00200832 predicted 445
10 SASI_Rn02_00200833 predicted 953
11 SASI_Rn01_00099818 predicted 434
12 SASI_Rn01_00099821 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123552 predicted 1090
2 SASI_Mm01_00123553 predicted 924
3 SASI_Mm01_00123554 predicted 470
4 SASI_Mm02_00290348 predicted 955
5 SASI_Mm01_00123555 predicted 504
6 SASI_Mm01_00123556 predicted 404
7 SASI_Mm01_00123557 predicted 660
8 SASI_Mm01_00123558 predicted 453
9 SASI_Mm01_00123559 predicted 1001
10 SASI_Mm01_00123560 predicted 674
11 SASI_Mm01_00123561 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061855 predicted 1066
2 SASI_Mm02_00321213 predicted 904
3 SASI_Mm01_00061858 predicted 443
4 SASI_Mm02_00321214 predicted 919
5 SASI_Mm01_00061860 predicted 474
6 SASI_Mm01_00061863 predicted 375
7 SASI_Mm02_00321215 predicted 633
8 SASI_Mm02_00321216 predicted 425
9 SASI_Mm02_00321217 predicted 975
10 SASI_Mm02_00321218 predicted 643
11 SASI_Mm01_00061856 predicted 346
12 SASI_Mm01_00061857 predicted 349
13 SASI_Mm01_00061859 predicted 781
14 SASI_Mm01_00061861 predicted 516
15 SASI_Mm01_00061862 predicted 880
16 SASI_Mm01_00061864 predicted 479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003362
VALIDATED
UNG MISSION shRNA Bacterial Glycerol Stock
uracil-DNA glycosylase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003362.2-758s21c1
Sequence:CCGGCCATCAAGCCAACTCTCATAACTCGAGTTATGAGAGTTGGCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003362.2-893s21c1
Sequence:CCGGTGATAGGAAGCGGCACCATGTCTCGAGACATGGTGCCGCTTCCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003362.2-656s21c1
Sequence:CCGGGTCTACAGACATAGAGGATTTCTCGAGAAATCCTCTATGTCTGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003362.2-807s21c1
Sequence:CCGGGCAGTTGTGTCCTGGCTAAATCTCGAGATTTAGCCAGGACACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003362.2-1066s21c1
Sequence:CCGGGAAGCTGCTGTTAACGTATTTCTCGAGAAATACGTTAACAGCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003362.2-682s21c1
Sequence:CCGGATCCTGGCCATGGAGATTTATCTCGAGATAAATCTCCATGGCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003362.2-1250s21c1
Sequence:CCGGGCAACATGGCTTCGGCCTAAACTCGAGTTTAGGCCGAAGCCATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003362.2-1577s1c1
Sequence:CCGGGCCCAGAAATTAGGGCTCAATCTCGAGATTGAGCCCTAATTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003362.2-807s1c1
Sequence:CCGGGCAGTTGTGTCCTGGCTAAATCTCGAGATTTAGCCAGGACACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003362.2-624s1c1
Sequence:CCGGCCGCCCAGTTTGGAGAACATTCTCGAGAATGTTCTCCAAACTGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003362.2-941s1c1
Sequence:CCGGGTCAGTGTATAGAGGGTTCTTCTCGAGAAGAACCCTCTATACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003362.2-558s1c1
Sequence:CCGGGATCCATATCATGGACCTAATCTCGAGATTAGGTCCATGATATGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003362
VALIDATED
UNG MISSION shRNA shRNA Plasmid DNA
uracil-DNA glycosylase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003362.2-758s21c1
Sequence:CCGGCCATCAAGCCAACTCTCATAACTCGAGTTATGAGAGTTGGCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003362.2-893s21c1
Sequence:CCGGTGATAGGAAGCGGCACCATGTCTCGAGACATGGTGCCGCTTCCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003362.2-656s21c1
Sequence:CCGGGTCTACAGACATAGAGGATTTCTCGAGAAATCCTCTATGTCTGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003362.2-807s21c1
Sequence:CCGGGCAGTTGTGTCCTGGCTAAATCTCGAGATTTAGCCAGGACACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003362.2-1066s21c1
Sequence:CCGGGAAGCTGCTGTTAACGTATTTCTCGAGAAATACGTTAACAGCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003362.2-682s21c1
Sequence:CCGGATCCTGGCCATGGAGATTTATCTCGAGATAAATCTCCATGGCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003362.2-1250s21c1
Sequence:CCGGGCAACATGGCTTCGGCCTAAACTCGAGTTTAGGCCGAAGCCATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003362.2-1577s1c1
Sequence:CCGGGCCCAGAAATTAGGGCTCAATCTCGAGATTGAGCCCTAATTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003362.2-807s1c1
Sequence:CCGGGCAGTTGTGTCCTGGCTAAATCTCGAGATTTAGCCAGGACACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003362.2-624s1c1
Sequence:CCGGCCGCCCAGTTTGGAGAACATTCTCGAGAATGTTCTCCAAACTGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003362.2-941s1c1
Sequence:CCGGGTCAGTGTATAGAGGGTTCTTCTCGAGAAGAACCCTCTATACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003362.2-558s1c1
Sequence:CCGGGATCCATATCATGGACCTAATCTCGAGATTAGGTCCATGATATGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003362
VALIDATED
UNG MISSION shRNA Lentiviral Transduction Particles
uracil-DNA glycosylase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003362.2-758s21c1
Sequence:CCGGCCATCAAGCCAACTCTCATAACTCGAGTTATGAGAGTTGGCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003362.2-893s21c1
Sequence:CCGGTGATAGGAAGCGGCACCATGTCTCGAGACATGGTGCCGCTTCCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003362.2-656s21c1
Sequence:CCGGGTCTACAGACATAGAGGATTTCTCGAGAAATCCTCTATGTCTGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003362.2-807s21c1
Sequence:CCGGGCAGTTGTGTCCTGGCTAAATCTCGAGATTTAGCCAGGACACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003362.2-1066s21c1
Sequence:CCGGGAAGCTGCTGTTAACGTATTTCTCGAGAAATACGTTAACAGCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003362.2-682s21c1
Sequence:CCGGATCCTGGCCATGGAGATTTATCTCGAGATAAATCTCCATGGCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003362.2-1250s21c1
Sequence:CCGGGCAACATGGCTTCGGCCTAAACTCGAGTTTAGGCCGAAGCCATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003362.2-1577s1c1
Sequence:CCGGGCCCAGAAATTAGGGCTCAATCTCGAGATTGAGCCCTAATTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003362.2-807s1c1
Sequence:CCGGGCAGTTGTGTCCTGGCTAAATCTCGAGATTTAGCCAGGACACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003362.2-624s1c1
Sequence:CCGGCCGCCCAGTTTGGAGAACATTCTCGAGAATGTTCTCCAAACTGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003362.2-941s1c1
Sequence:CCGGGTCAGTGTATAGAGGGTTCTTCTCGAGAAGAACCCTCTATACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003362.2-558s1c1
Sequence:CCGGGATCCATATCATGGACCTAATCTCGAGATTAGGTCCATGATATGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011677
VALIDATED
UNG MISSION shRNA Bacterial Glycerol Stock
uracil-DNA glycosylase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011677.2-343s21c1
Sequence:CCGGGCCGTACTTCGTCAAGCTAATCTCGAGATTAGCTTGACGAAGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011677.2-1065s21c1
Sequence:CCGGTGACACGGATAGATCTCTATACTCGAGTATAGAGATCTATCCGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011677.2-384s21c1
Sequence:CCGGGGAACCACCACAAGGTCTATCCTCGAGGATAGACCTTGTGGTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011677.2-479s21c1
Sequence:CCGGGATCCCTATCACGGACCTAATCTCGAGATTAGGTCCGTGATAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011677.2-352s21c1
Sequence:CCGGCGTCAAGCTAATGGGATTTGTCTCGAGACAAATCCCATTAGCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011677.1-1262s1c1
Sequence:CCGGCCGCTTTATCCTTTAGAGTTACTCGAGTAACTCTAAAGGATAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011677.1-299s1c1
Sequence:CCGGGCCGTACTTCGTCAAGCTAATCTCGAGATTAGCTTGACGAAGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011677.1-435s1c1
Sequence:CCGGGATCCCTATCACGGACCTAATCTCGAGATTAGGTCCGTGATAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011677.1-309s1c1
Sequence:CCGGGTCAAGCTAATGGGATTTGTTCTCGAGAACAAATCCCATTAGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011677.1-308s1c1
Sequence:CCGGCGTCAAGCTAATGGGATTTGTCTCGAGACAAATCCCATTAGCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011677
VALIDATED
UNG MISSION shRNA shRNA Plasmid DNA
uracil-DNA glycosylase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011677.2-343s21c1
Sequence:CCGGGCCGTACTTCGTCAAGCTAATCTCGAGATTAGCTTGACGAAGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011677.2-1065s21c1
Sequence:CCGGTGACACGGATAGATCTCTATACTCGAGTATAGAGATCTATCCGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011677.2-384s21c1
Sequence:CCGGGGAACCACCACAAGGTCTATCCTCGAGGATAGACCTTGTGGTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011677.2-479s21c1
Sequence:CCGGGATCCCTATCACGGACCTAATCTCGAGATTAGGTCCGTGATAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011677.2-352s21c1
Sequence:CCGGCGTCAAGCTAATGGGATTTGTCTCGAGACAAATCCCATTAGCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011677.1-1262s1c1
Sequence:CCGGCCGCTTTATCCTTTAGAGTTACTCGAGTAACTCTAAAGGATAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011677.1-299s1c1
Sequence:CCGGGCCGTACTTCGTCAAGCTAATCTCGAGATTAGCTTGACGAAGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011677.1-435s1c1
Sequence:CCGGGATCCCTATCACGGACCTAATCTCGAGATTAGGTCCGTGATAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011677.1-309s1c1
Sequence:CCGGGTCAAGCTAATGGGATTTGTTCTCGAGAACAAATCCCATTAGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011677.1-308s1c1
Sequence:CCGGCGTCAAGCTAATGGGATTTGTCTCGAGACAAATCCCATTAGCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011677
VALIDATED
UNG MISSION shRNA Lentiviral Transduction Particles
uracil-DNA glycosylase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011677.2-343s21c1
Sequence:CCGGGCCGTACTTCGTCAAGCTAATCTCGAGATTAGCTTGACGAAGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011677.2-1065s21c1
Sequence:CCGGTGACACGGATAGATCTCTATACTCGAGTATAGAGATCTATCCGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011677.2-384s21c1
Sequence:CCGGGGAACCACCACAAGGTCTATCCTCGAGGATAGACCTTGTGGTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011677.2-479s21c1
Sequence:CCGGGATCCCTATCACGGACCTAATCTCGAGATTAGGTCCGTGATAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011677.2-352s21c1
Sequence:CCGGCGTCAAGCTAATGGGATTTGTCTCGAGACAAATCCCATTAGCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011677.1-1262s1c1
Sequence:CCGGCCGCTTTATCCTTTAGAGTTACTCGAGTAACTCTAAAGGATAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011677.1-299s1c1
Sequence:CCGGGCCGTACTTCGTCAAGCTAATCTCGAGATTAGCTTGACGAAGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011677.1-435s1c1
Sequence:CCGGGATCCCTATCACGGACCTAATCTCGAGATTAGGTCCGTGATAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011677.1-309s1c1
Sequence:CCGGGTCAAGCTAATGGGATTTGTTCTCGAGAACAAATCCCATTAGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011677.1-308s1c1
Sequence:CCGGCGTCAAGCTAATGGGATTTGTCTCGAGACAAATCCCATTAGCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks