EMAIL THIS PAGE TO A FRIEND

UNK

unkempt homolog (Drosophila)

Synonyms: ZC3H5 ZC3HDC5
UniProtKB ID: Q9C0B0
Gene ID:
Mouse(217331) unkempt homolog (Drosophila)
Rat(360663) unkempt homolog (Drosophila)
Horse(100059450) unkempt homolog (Drosophila)
domestic cat(101081095) unkempt homolog (Drosophila)
dog(444855) unkempt homolog (Drosophila)
chicken(417371) unkempt homolog (Drosophila)
Zebrafish(393205) unkempt homolog (Drosophila)
cow(510090) unkempt homolog (Drosophila)
sheep(101119407) unkempt homolog (Drosophila)
naked mole-rat(101699283) unkempt homolog (Drosophila)
domestic guinea pig(100719641) unkempt homolog (Drosophila)
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172569 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172569 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172569 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080419 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU075381 MISSION® esiRNA esiRNA targeting mouse Unk (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080419 Rosetta Predictions human pricing
XM_036115 Rosetta Predictions human pricing
NM_001108306 Rosetta Predictions rat pricing
NM_172569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314666 predicted 360
2 SASI_Hs02_00314667 predicted 318
3 SASI_Hs02_00314668 predicted 628
4 SASI_Hs02_00314669 predicted 1316
5 SASI_Hs02_00314670 predicted 721
6 SASI_Hs02_00314671 predicted 576
7 SASI_Hs02_00314672 predicted 484
8 SASI_Hs02_00314673 predicted 696
9 SASI_Hs02_00314674 predicted 1999
10 SASI_Hs02_00314675 predicted 1757
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_036115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280865 predicted 363
2 SASI_Hs01_00280866 predicted 320
3 SASI_Hs01_00280867 predicted 633
4 SASI_Hs01_00280868 predicted 1322
5 SASI_Hs01_00280869 predicted 585
6 SASI_Hs01_00280870 predicted 485
7 SASI_Hs01_00280871 predicted 705
8 SASI_Hs01_00280872 predicted 628
9 SASI_Hs01_00280873 predicted 2005
10 SASI_Hs01_00280874 predicted 1760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237359 predicted 2956
2 SASI_Rn02_00237360 predicted 1427
3 SASI_Rn02_00237361 predicted 2909
4 SASI_Rn02_00237362 predicted 1563
5 SASI_Rn02_00237363 predicted 1662
6 SASI_Rn02_00237364 predicted 2938
7 SASI_Rn02_00237365 predicted 1172
8 SASI_Rn02_00237366 predicted 1736
9 SASI_Rn02_00237367 predicted 1543
10 SASI_Rn02_00237368 predicted 2943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186195 predicted 583
2 SASI_Mm01_00186196 predicted 412
3 SASI_Mm01_00186197 predicted 1841
4 SASI_Mm01_00186198 predicted 533
5 SASI_Mm01_00186199 predicted 1598
6 SASI_Mm01_00186200 predicted 319
7 SASI_Mm01_00186201 predicted 415
8 SASI_Mm01_00186202 predicted 229
9 SASI_Mm01_00186203 predicted 1300
10 SASI_Mm01_00186204 predicted 1013
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172569
VALIDATED
UNK MISSION shRNA Bacterial Glycerol Stock
unkempt homolog (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172569.1-3464s1c1
Sequence:CCGGCGTGCCTGTCTGATGTGTTTACTCGAGTAAACACATCAGACAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172569.1-1357s1c1
Sequence:CCGGGAATTTCAAGTGCCAGGCTAACTCGAGTTAGCCTGGCACTTGAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172569.1-2359s1c1
Sequence:CCGGGCAGTCAGTGAAATGCCTTAACTCGAGTTAAGGCATTTCACTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172569.1-1845s1c1
Sequence:CCGGGCCACTTGAGTCAGTCAGAAACTCGAGTTTCTGACTGACTCAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172569.1-456s1c1
Sequence:CCGGGCATCCATGAGACAGACTCAACTCGAGTTGAGTCTGTCTCATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172569.3-422s21c1
Sequence:CCGGGGTATCACCTTCGTTACTATACTCGAGTATAGTAACGAAGGTGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172569.3-326s21c1
Sequence:CCGGATGTCTACTGCACGAAGTATGCTCGAGCATACTTCGTGCAGTAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172569.3-1882s21c1
Sequence:CCGGTCAGCATCACATGGATCTTTGCTCGAGCAAAGATCCATGTGATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172569.3-1592s21c1
Sequence:CCGGACACGGTAGAGTCGGTCATAGCTCGAGCTATGACCGACTCTACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172569.3-2987s21c1
Sequence:CCGGAGGCAGGTCTGAAACTCTAAACTCGAGTTTAGAGTTTCAGACCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172569
VALIDATED
UNK MISSION shRNA shRNA Plasmid DNA
unkempt homolog (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172569.1-3464s1c1
Sequence:CCGGCGTGCCTGTCTGATGTGTTTACTCGAGTAAACACATCAGACAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172569.1-1357s1c1
Sequence:CCGGGAATTTCAAGTGCCAGGCTAACTCGAGTTAGCCTGGCACTTGAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172569.1-2359s1c1
Sequence:CCGGGCAGTCAGTGAAATGCCTTAACTCGAGTTAAGGCATTTCACTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172569.1-1845s1c1
Sequence:CCGGGCCACTTGAGTCAGTCAGAAACTCGAGTTTCTGACTGACTCAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172569.1-456s1c1
Sequence:CCGGGCATCCATGAGACAGACTCAACTCGAGTTGAGTCTGTCTCATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172569.3-422s21c1
Sequence:CCGGGGTATCACCTTCGTTACTATACTCGAGTATAGTAACGAAGGTGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172569.3-326s21c1
Sequence:CCGGATGTCTACTGCACGAAGTATGCTCGAGCATACTTCGTGCAGTAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172569.3-1882s21c1
Sequence:CCGGTCAGCATCACATGGATCTTTGCTCGAGCAAAGATCCATGTGATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172569.3-1592s21c1
Sequence:CCGGACACGGTAGAGTCGGTCATAGCTCGAGCTATGACCGACTCTACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172569.3-2987s21c1
Sequence:CCGGAGGCAGGTCTGAAACTCTAAACTCGAGTTTAGAGTTTCAGACCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172569
VALIDATED
UNK MISSION shRNA Lentiviral Transduction Particles
unkempt homolog (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172569.1-3464s1c1
Sequence:CCGGCGTGCCTGTCTGATGTGTTTACTCGAGTAAACACATCAGACAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172569.1-1357s1c1
Sequence:CCGGGAATTTCAAGTGCCAGGCTAACTCGAGTTAGCCTGGCACTTGAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172569.1-2359s1c1
Sequence:CCGGGCAGTCAGTGAAATGCCTTAACTCGAGTTAAGGCATTTCACTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172569.1-1845s1c1
Sequence:CCGGGCCACTTGAGTCAGTCAGAAACTCGAGTTTCTGACTGACTCAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172569.1-456s1c1
Sequence:CCGGGCATCCATGAGACAGACTCAACTCGAGTTGAGTCTGTCTCATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172569.3-422s21c1
Sequence:CCGGGGTATCACCTTCGTTACTATACTCGAGTATAGTAACGAAGGTGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172569.3-326s21c1
Sequence:CCGGATGTCTACTGCACGAAGTATGCTCGAGCATACTTCGTGCAGTAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172569.3-1882s21c1
Sequence:CCGGTCAGCATCACATGGATCTTTGCTCGAGCAAAGATCCATGTGATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172569.3-1592s21c1
Sequence:CCGGACACGGTAGAGTCGGTCATAGCTCGAGCTATGACCGACTCTACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172569.3-2987s21c1
Sequence:CCGGAGGCAGGTCTGAAACTCTAAACTCGAGTTTAGAGTTTCAGACCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080419
VALIDATED
UNK MISSION shRNA Bacterial Glycerol Stock
unkempt homolog (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080419.1-1821s21c1
Sequence:CCGGCCTGGAGAAGACTTTCGATAACTCGAGTTATCGAAAGTCTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080419.1-459s21c1
Sequence:CCGGTCGGGACGGCACCTTCAATTACTCGAGTAATTGAAGGTGCCGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080419.1-172s21c1
Sequence:CCGGGGACCGCGCAGACTGAATAATCTCGAGATTATTCAGTCTGCGCGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080419.1-2521s21c1
Sequence:CCGGCAGTCGGTGAAATGCCTTAAGCTCGAGCTTAAGGCATTTCACCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253767    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080419.1-3502s21c1
Sequence:CCGGCTACCAGGCTGGTACTCATTCCTCGAGGAATGAGTACCAGCCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080419
VALIDATED
UNK MISSION shRNA shRNA Plasmid DNA
unkempt homolog (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080419.1-1821s21c1
Sequence:CCGGCCTGGAGAAGACTTTCGATAACTCGAGTTATCGAAAGTCTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080419.1-459s21c1
Sequence:CCGGTCGGGACGGCACCTTCAATTACTCGAGTAATTGAAGGTGCCGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080419.1-172s21c1
Sequence:CCGGGGACCGCGCAGACTGAATAATCTCGAGATTATTCAGTCTGCGCGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080419.1-2521s21c1
Sequence:CCGGCAGTCGGTGAAATGCCTTAAGCTCGAGCTTAAGGCATTTCACCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253767    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080419.1-3502s21c1
Sequence:CCGGCTACCAGGCTGGTACTCATTCCTCGAGGAATGAGTACCAGCCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080419
VALIDATED
UNK MISSION shRNA Lentiviral Transduction Particles
unkempt homolog (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080419.1-1821s21c1
Sequence:CCGGCCTGGAGAAGACTTTCGATAACTCGAGTTATCGAAAGTCTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080419.1-459s21c1
Sequence:CCGGTCGGGACGGCACCTTCAATTACTCGAGTAATTGAAGGTGCCGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080419.1-172s21c1
Sequence:CCGGGGACCGCGCAGACTGAATAATCTCGAGATTATTCAGTCTGCGCGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080419.1-2521s21c1
Sequence:CCGGCAGTCGGTGAAATGCCTTAAGCTCGAGCTTAAGGCATTTCACCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253767    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080419.1-3502s21c1
Sequence:CCGGCTACCAGGCTGGTACTCATTCCTCGAGGAATGAGTACCAGCCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks