EMAIL THIS PAGE TO A FRIEND

UNKL

unkempt homolog (Drosophila)-like

Synonyms: C16orf28 ZC3H5L ZC3HDC5L
Gene ID:
Human(64718) Summary: This gene encodes a RING finger protein that may function in Rac signaling. It can bind to Brg/Brm-associated factor 60b and can promote its ubiquitination. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Mouse(74154) unkempt-like (Drosophila)
Rat(302987) unkempt homolog (Drosophila)-like
cow(522441) unkempt homolog (Drosophila)-like
sheep(101108712) unkempt homolog (Drosophila)-like
domestic guinea pig(100723408) unkempt homolog (Drosophila)-like
naked mole-rat(101715118) unkempt homolog (Drosophila)-like
Zebrafish(565405) unkempt homolog (Drosophila)-like
chicken(416593) unkempt homolog (Drosophila)-like
dog(490077) unkempt homolog (Drosophila)-like
domestic cat(101088045) unkempt homolog (Drosophila)-like
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024023 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023076 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU000821 MISSION® esiRNA esiRNA targeting mouse Unkl (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037125 Rosetta Predictions human pricing
NM_023076 Rosetta Predictions human pricing
XM_001059160 Rosetta Predictions rat pricing
XM_220238 Rosetta Predictions rat pricing
NM_028789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037979 predicted 240
2 SASI_Hs01_00037980 predicted 672
3 SASI_Hs01_00037981 predicted 594
4 SASI_Hs01_00037982 predicted 316
5 SASI_Hs01_00037983 predicted 242
6 SASI_Hs01_00037984 predicted 331
7 SASI_Hs01_00037985 predicted 665
8 SASI_Hs01_00037986 predicted 667
9 SASI_Hs01_00037987 predicted 329
10 SASI_Hs01_00037988 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356316 predicted 555
2 SASI_Hs01_00014284 predicted 1141
3 SASI_Hs01_00014285 predicted 1264
4 SASI_Hs01_00014288 predicted 1009
5 SASI_Hs02_00356317 predicted 1574
6 SASI_Hs02_00356318 predicted 1324
7 SASI_Hs01_00014292 predicted 1198
8 SASI_Hs01_00014290 predicted 1246
9 SASI_Hs02_00356319 predicted 1473
10 SASI_Hs02_00356320 predicted 618
11 SASI_Hs01_00014283 predicted 1421
12 SASI_Hs01_00014286 predicted 1415
13 SASI_Hs01_00014287 predicted 1438
14 SASI_Hs01_00014289 predicted 1443
15 SASI_Hs01_00014291 predicted 1428
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292182 predicted 1565
2 SASI_Rn02_00292183 predicted 1562
3 SASI_Rn02_00292184 predicted 865
4 SASI_Rn02_00292185 predicted 1294
5 SASI_Rn02_00292186 predicted 1299
6 SASI_Rn02_00292187 predicted 1283
7 SASI_Rn02_00292188 predicted 250
8 SASI_Rn02_00292189 predicted 1912
9 SASI_Rn02_00292190 predicted 1745
10 SASI_Rn02_00292191 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379165 predicted 1568
2 SASI_Rn02_00379166 predicted 1565
3 SASI_Rn02_00379167 predicted 863
4 SASI_Rn02_00379168 predicted 1294
5 SASI_Rn02_00379169 predicted 1300
6 SASI_Rn02_00379170 predicted 1281
7 SASI_Rn02_00379171 predicted 248
8 SASI_Rn02_00379172 predicted 1913
9 SASI_Rn02_00379173 predicted 1746
10 SASI_Rn02_00379174 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071861 predicted 1223
2 SASI_Mm01_00071862 predicted 1000
3 SASI_Mm02_00334397 predicted 1245
4 SASI_Mm01_00071864 predicted 1153
5 SASI_Mm01_00071866 predicted 391
6 SASI_Mm01_00071867 predicted 381
7 SASI_Mm02_00334398 predicted 1186
8 SASI_Mm01_00071868 predicted 1273
9 SASI_Mm01_00071869 predicted 545
10 SASI_Mm01_00071870 predicted 212
11 SASI_Mm01_00071863 predicted 1193
12 SASI_Mm01_00071865 predicted 1167
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028789
UNKL MISSION shRNA Bacterial Glycerol Stock
unkempt homolog (Drosophila)-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028789.1-181s1c1
Sequence:CCGGGCGTCCTTAGATAAAGACTTACTCGAGTAAGTCTTTATCTAAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028789.1-213s1c1
Sequence:CCGGCCTTGGATTGACAGGTCTGAACTCGAGTTCAGACCTGTCAATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028789.1-555s1c1
Sequence:CCGGAGAATTAGAGGGCCTGGGTTTCTCGAGAAACCCAGGCCCTCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028789.1-430s1c1
Sequence:CCGGGCCTGTGATGCCTGGCAGAGACTCGAGTCTCTGCCAGGCATCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028789.1-502s1c1
Sequence:CCGGCTGGCCCTGCAGAGGAAAGAACTCGAGTTCTTTCCTCTGCAGGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028789
UNKL MISSION shRNA shRNA Plasmid DNA
unkempt homolog (Drosophila)-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028789.1-181s1c1
Sequence:CCGGGCGTCCTTAGATAAAGACTTACTCGAGTAAGTCTTTATCTAAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028789.1-213s1c1
Sequence:CCGGCCTTGGATTGACAGGTCTGAACTCGAGTTCAGACCTGTCAATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028789.1-555s1c1
Sequence:CCGGAGAATTAGAGGGCCTGGGTTTCTCGAGAAACCCAGGCCCTCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028789.1-430s1c1
Sequence:CCGGGCCTGTGATGCCTGGCAGAGACTCGAGTCTCTGCCAGGCATCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028789.1-502s1c1
Sequence:CCGGCTGGCCCTGCAGAGGAAAGAACTCGAGTTCTTTCCTCTGCAGGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028789
UNKL MISSION shRNA Lentiviral Transduction Particles
unkempt homolog (Drosophila)-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028789.1-181s1c1
Sequence:CCGGGCGTCCTTAGATAAAGACTTACTCGAGTAAGTCTTTATCTAAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028789.1-213s1c1
Sequence:CCGGCCTTGGATTGACAGGTCTGAACTCGAGTTCAGACCTGTCAATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028789.1-555s1c1
Sequence:CCGGAGAATTAGAGGGCCTGGGTTTCTCGAGAAACCCAGGCCCTCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028789.1-430s1c1
Sequence:CCGGGCCTGTGATGCCTGGCAGAGACTCGAGTCTCTGCCAGGCATCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028789.1-502s1c1
Sequence:CCGGCTGGCCCTGCAGAGGAAAGAACTCGAGTTCTTTCCTCTGCAGGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024023
UNKL MISSION shRNA Bacterial Glycerol Stock
unkempt homolog (Drosophila)-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024023.1-237s1c1
Sequence:CCGGGTACTGCTCCAAGTACAACGACTCGAGTCGTTGTACTTGGAGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024023.1-1405s1c1
Sequence:CCGGGTGTTCCCTATCTACAAATCTCTCGAGAGATTTGTAGATAGGGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024023.1-1346s1c1
Sequence:CCGGGAAATGACTTTGCCTGTGATGCTCGAGCATCACAGGCAAAGTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024023.1-1657s1c1
Sequence:CCGGGCTCACGGTGTTTATGTCTTTCTCGAGAAAGACATAAACACCGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024023.1-822s1c1
Sequence:CCGGGATTGAGAAGATCCTGAGCGACTCGAGTCGCTCAGGATCTTCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024023
UNKL MISSION shRNA shRNA Plasmid DNA
unkempt homolog (Drosophila)-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024023.1-237s1c1
Sequence:CCGGGTACTGCTCCAAGTACAACGACTCGAGTCGTTGTACTTGGAGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024023.1-1405s1c1
Sequence:CCGGGTGTTCCCTATCTACAAATCTCTCGAGAGATTTGTAGATAGGGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024023.1-1346s1c1
Sequence:CCGGGAAATGACTTTGCCTGTGATGCTCGAGCATCACAGGCAAAGTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024023.1-1657s1c1
Sequence:CCGGGCTCACGGTGTTTATGTCTTTCTCGAGAAAGACATAAACACCGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024023.1-822s1c1
Sequence:CCGGGATTGAGAAGATCCTGAGCGACTCGAGTCGCTCAGGATCTTCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024023
UNKL MISSION shRNA Lentiviral Transduction Particles
unkempt homolog (Drosophila)-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024023.1-237s1c1
Sequence:CCGGGTACTGCTCCAAGTACAACGACTCGAGTCGTTGTACTTGGAGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024023.1-1405s1c1
Sequence:CCGGGTGTTCCCTATCTACAAATCTCTCGAGAGATTTGTAGATAGGGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024023.1-1346s1c1
Sequence:CCGGGAAATGACTTTGCCTGTGATGCTCGAGCATCACAGGCAAAGTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024023.1-1657s1c1
Sequence:CCGGGCTCACGGTGTTTATGTCTTTCTCGAGAAAGACATAAACACCGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024023.1-822s1c1
Sequence:CCGGGATTGAGAAGATCCTGAGCGACTCGAGTCGCTCAGGATCTTCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023076
UNKL MISSION shRNA Bacterial Glycerol Stock
unkempt homolog (Drosophila)-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023076.2-722s1c1
Sequence:CCGGCTCTTCGAGTGCAAGTCCAAACTCGAGTTTGGACTTGCACTCGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023076.2-1162s1c1
Sequence:CCGGCCTGTCAGCACCACATCCTCTCTCGAGAGAGGATGTGGTGCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023076.2-1031s1c1
Sequence:CCGGCCTGCCGAAGCTGCACTCGCTCTCGAGAGCGAGTGCAGCTTCGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023076.2-645s1c1
Sequence:CCGGCCCGGGAGCATCTGGGACTTTCTCGAGAAAGTCCCAGATGCTCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023076.2-623s1c1
Sequence:CCGGCTGCAATGGTTTGAACGGTGTCTCGAGACACCGTTCAAACCATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023076
UNKL MISSION shRNA shRNA Plasmid DNA
unkempt homolog (Drosophila)-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023076.2-722s1c1
Sequence:CCGGCTCTTCGAGTGCAAGTCCAAACTCGAGTTTGGACTTGCACTCGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023076.2-1162s1c1
Sequence:CCGGCCTGTCAGCACCACATCCTCTCTCGAGAGAGGATGTGGTGCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023076.2-1031s1c1
Sequence:CCGGCCTGCCGAAGCTGCACTCGCTCTCGAGAGCGAGTGCAGCTTCGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023076.2-645s1c1
Sequence:CCGGCCCGGGAGCATCTGGGACTTTCTCGAGAAAGTCCCAGATGCTCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023076.2-623s1c1
Sequence:CCGGCTGCAATGGTTTGAACGGTGTCTCGAGACACCGTTCAAACCATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023076
UNKL MISSION shRNA Lentiviral Transduction Particles
unkempt homolog (Drosophila)-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023076.2-722s1c1
Sequence:CCGGCTCTTCGAGTGCAAGTCCAAACTCGAGTTTGGACTTGCACTCGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023076.2-1162s1c1
Sequence:CCGGCCTGTCAGCACCACATCCTCTCTCGAGAGAGGATGTGGTGCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023076.2-1031s1c1
Sequence:CCGGCCTGCCGAAGCTGCACTCGCTCTCGAGAGCGAGTGCAGCTTCGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023076.2-645s1c1
Sequence:CCGGCCCGGGAGCATCTGGGACTTTCTCGAGAAAGTCCCAGATGCTCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023076.2-623s1c1
Sequence:CCGGCTGCAATGGTTTGAACGGTGTCTCGAGACACCGTTCAAACCATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks