EMAIL THIS PAGE TO A FRIEND

UNQ9370

Species: Human UNQ9370(400454)
Gene ID:
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_375263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375263 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207447 Rosetta Predictions human pricing
XR_041833 Rosetta Predictions human pricing
XR_041834 Rosetta Predictions human pricing
XR_041835 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212661 predicted 335
2 SASI_Hs01_00212662 predicted 343
3 SASI_Hs01_00212663 predicted 266
4 SASI_Hs01_00212664 predicted 1120
5 SASI_Hs01_00212665 predicted 956
6 SASI_Hs01_00212666 predicted 1129
7 SASI_Hs01_00212667 predicted 1042
8 SASI_Hs01_00212668 predicted 520
9 SASI_Hs01_00212669 predicted 166
10 SASI_Hs01_00212670 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530733 predicted 210
2 SASI_Hs02_00530734 predicted 207
3 SASI_Hs02_00530735 predicted 25
4 SASI_Hs02_00530736 predicted 381
5 SASI_Hs02_00530737 predicted 337
6 SASI_Hs02_00530738 predicted 76
7 SASI_Hs02_00530739 predicted 385
8 SASI_Hs02_00530740 predicted 30
9 SASI_Hs02_00530741 predicted 32
10 SASI_Hs02_00530742 predicted 109
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530743 predicted 204
2 SASI_Hs02_00530744 predicted 207
3 SASI_Hs02_00530745 predicted 26
4 SASI_Hs02_00530746 predicted 382
5 SASI_Hs02_00530747 predicted 336
6 SASI_Hs02_00530748 predicted 78
7 SASI_Hs02_00530749 predicted 381
8 SASI_Hs02_00530750 predicted 28
9 SASI_Hs02_00530751 predicted 33
10 SASI_Hs02_00530752 predicted 106
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530753 predicted 201
2 SASI_Hs02_00530754 predicted 200
3 SASI_Hs02_00530755 predicted 31
4 SASI_Hs02_00530756 predicted 379
5 SASI_Hs02_00530757 predicted 337
6 SASI_Hs02_00530758 predicted 69
7 SASI_Hs02_00530759 predicted 381
8 SASI_Hs02_00530760 predicted 28
9 SASI_Hs02_00530761 predicted 28
10 SASI_Hs02_00530762 predicted 101
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375263
UNQ9370 MISSION shRNA Bacterial Glycerol Stock
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375263.1-639s1c1
Sequence:CCGGGCAGGTTTGTTACCAGGGTATCTCGAGATACCCTGGTAACAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375263.1-521s1c1
Sequence:CCGGCAATCTCAGTTTGCCTTTGAACTCGAGTTCAAAGGCAAACTGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375263.1-511s1c1
Sequence:CCGGCAGTTTACCTCAATCTCAGTTCTCGAGAACTGAGATTGAGGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375263.1-393s1c1
Sequence:CCGGCAATCGAACATTGTCAGCCCACTCGAGTGGGCTGACAATGTTCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375263.1-1042s1c1
Sequence:CCGGGCATAGGCTCTTGGCTAAGATCTCGAGATCTTAGCCAAGAGCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375263.1-1337s1c1
Sequence:CCGGCCTCACCTGTACAATGGGTATCTCGAGATACCCATTGTACAGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375263.1-546s1c1
Sequence:CCGGGTTCACAGGCTATCTCTGAAACTCGAGTTTCAGAGATAGCCTGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375263.1-510s1c1
Sequence:CCGGGCAGTTTACCTCAATCTCAGTCTCGAGACTGAGATTGAGGTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375263.1-945s1c1
Sequence:CCGGCCAAGCATTTCTCAGAGGCTACTCGAGTAGCCTCTGAGAAATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375263.1-503s1c1
Sequence:CCGGCAAGGCTGCAGTTTACCTCAACTCGAGTTGAGGTAAACTGCAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375263
UNQ9370 MISSION shRNA shRNA Plasmid DNA
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375263.1-639s1c1
Sequence:CCGGGCAGGTTTGTTACCAGGGTATCTCGAGATACCCTGGTAACAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375263.1-521s1c1
Sequence:CCGGCAATCTCAGTTTGCCTTTGAACTCGAGTTCAAAGGCAAACTGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375263.1-511s1c1
Sequence:CCGGCAGTTTACCTCAATCTCAGTTCTCGAGAACTGAGATTGAGGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375263.1-393s1c1
Sequence:CCGGCAATCGAACATTGTCAGCCCACTCGAGTGGGCTGACAATGTTCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375263.1-1042s1c1
Sequence:CCGGGCATAGGCTCTTGGCTAAGATCTCGAGATCTTAGCCAAGAGCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375263.1-1337s1c1
Sequence:CCGGCCTCACCTGTACAATGGGTATCTCGAGATACCCATTGTACAGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375263.1-546s1c1
Sequence:CCGGGTTCACAGGCTATCTCTGAAACTCGAGTTTCAGAGATAGCCTGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375263.1-510s1c1
Sequence:CCGGGCAGTTTACCTCAATCTCAGTCTCGAGACTGAGATTGAGGTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375263.1-945s1c1
Sequence:CCGGCCAAGCATTTCTCAGAGGCTACTCGAGTAGCCTCTGAGAAATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375263.1-503s1c1
Sequence:CCGGCAAGGCTGCAGTTTACCTCAACTCGAGTTGAGGTAAACTGCAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375263
UNQ9370 MISSION shRNA Lentiviral Transduction Particles
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375263.1-639s1c1
Sequence:CCGGGCAGGTTTGTTACCAGGGTATCTCGAGATACCCTGGTAACAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375263.1-521s1c1
Sequence:CCGGCAATCTCAGTTTGCCTTTGAACTCGAGTTCAAAGGCAAACTGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375263.1-511s1c1
Sequence:CCGGCAGTTTACCTCAATCTCAGTTCTCGAGAACTGAGATTGAGGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375263.1-393s1c1
Sequence:CCGGCAATCGAACATTGTCAGCCCACTCGAGTGGGCTGACAATGTTCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375263.1-1042s1c1
Sequence:CCGGGCATAGGCTCTTGGCTAAGATCTCGAGATCTTAGCCAAGAGCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375263.1-1337s1c1
Sequence:CCGGCCTCACCTGTACAATGGGTATCTCGAGATACCCATTGTACAGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375263.1-546s1c1
Sequence:CCGGGTTCACAGGCTATCTCTGAAACTCGAGTTTCAGAGATAGCCTGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375263.1-510s1c1
Sequence:CCGGGCAGTTTACCTCAATCTCAGTCTCGAGACTGAGATTGAGGTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375263.1-945s1c1
Sequence:CCGGCCAAGCATTTCTCAGAGGCTACTCGAGTAGCCTCTGAGAAATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_375263.1-503s1c1
Sequence:CCGGCAAGGCTGCAGTTTACCTCAACTCGAGTTGAGGTAAACTGCAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks