EMAIL THIS PAGE TO A FRIEND

UOX

urate oxidase, pseudogene

Synonyms: UOXP URICASE
Gene ID:
Mouse(22262) urate oxidase
Rat(114768) urate oxidase
Zebrafish(436604) urate oxidase
dog(490189) urate oxidase
cow(514113) urate oxidase
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009474 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009474 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009474 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003927 Rosetta Predictions human pricing
NM_053768 Rosetta Predictions rat pricing
NM_009474 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380531 predicted 245
2 SASI_Hs02_00380532 predicted 1264
3 SASI_Hs02_00380533 predicted 227
4 SASI_Hs02_00380534 predicted 328
5 SASI_Hs02_00380535 predicted 1005
6 SASI_Hs02_00380536 predicted 521
7 SASI_Hs02_00380537 predicted 1174
8 SASI_Hs02_00380538 predicted 576
9 SASI_Hs02_00380539 predicted 934
10 SASI_Hs02_00380540 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078809 predicted 201
2 SASI_Rn01_00078810 predicted 800
3 SASI_Rn01_00078812 predicted 968
4 SASI_Rn01_00078813 predicted 942
5 SASI_Rn01_00078814 predicted 308
6 SASI_Rn01_00078815 predicted 816
7 SASI_Rn01_00078817 predicted 814
8 SASI_Rn01_00078818 predicted 692
9 SASI_Rn02_00266563 predicted 742
10 SASI_Rn02_00266564 predicted 703
11 SASI_Rn01_00078811 predicted 541
12 SASI_Rn01_00078816 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158189 predicted 754
2 SASI_Mm01_00158191 predicted 832
3 SASI_Mm01_00158192 predicted 1105
4 SASI_Mm01_00158193 predicted 215
5 SASI_Mm01_00158194 predicted 820
6 SASI_Mm01_00158197 predicted 1052
7 SASI_Mm01_00158198 predicted 1039
8 SASI_Mm02_00316200 predicted 1098
9 SASI_Mm02_00316201 predicted 320
10 SASI_Mm02_00316202 predicted 228
11 SASI_Mm01_00158190 predicted 232
12 SASI_Mm01_00158195 predicted 805
13 SASI_Mm01_00158196 predicted 612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009474
UOX MISSION shRNA Bacterial Glycerol Stock
urate oxidase, pseudogene
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009474.3-1492s1c1
Sequence:CCGGGCTCAGGAGTTATTGGTGTTTCTCGAGAAACACCAATAACTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009474.3-233s1c1
Sequence:CCGGCGGTGATAATTCCGACATCATCTCGAGATGATGTCGGAATTATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009474.3-509s1c1
Sequence:CCGGCGTCATTCACTCTGGAATCAACTCGAGTTGATTCCAGAGTGAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009474.3-172s1c1
Sequence:CCGGGCATCAAAGAGGTGGCAACTTCTCGAGAAGTTGCCACCTCTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009474.3-830s1c1
Sequence:CCGGCCTTCCGAACATTCACTACTTCTCGAGAAGTAGTGAATGTTCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009474
UOX MISSION shRNA shRNA Plasmid DNA
urate oxidase, pseudogene
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009474.3-1492s1c1
Sequence:CCGGGCTCAGGAGTTATTGGTGTTTCTCGAGAAACACCAATAACTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009474.3-233s1c1
Sequence:CCGGCGGTGATAATTCCGACATCATCTCGAGATGATGTCGGAATTATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009474.3-509s1c1
Sequence:CCGGCGTCATTCACTCTGGAATCAACTCGAGTTGATTCCAGAGTGAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009474.3-172s1c1
Sequence:CCGGGCATCAAAGAGGTGGCAACTTCTCGAGAAGTTGCCACCTCTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009474.3-830s1c1
Sequence:CCGGCCTTCCGAACATTCACTACTTCTCGAGAAGTAGTGAATGTTCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009474
UOX MISSION shRNA Lentiviral Transduction Particles
urate oxidase, pseudogene
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009474.3-1492s1c1
Sequence:CCGGGCTCAGGAGTTATTGGTGTTTCTCGAGAAACACCAATAACTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009474.3-233s1c1
Sequence:CCGGCGGTGATAATTCCGACATCATCTCGAGATGATGTCGGAATTATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009474.3-509s1c1
Sequence:CCGGCGTCATTCACTCTGGAATCAACTCGAGTTGATTCCAGAGTGAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009474.3-172s1c1
Sequence:CCGGGCATCAAAGAGGTGGCAACTTCTCGAGAAGTTGCCACCTCTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009474.3-830s1c1
Sequence:CCGGCCTTCCGAACATTCACTACTTCTCGAGAAGTAGTGAATGTTCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks