EMAIL THIS PAGE TO A FRIEND

UPB1

ureidopropionase, beta

Synonyms: BUP1
UniProtKB ID: Q9UBR1, A3KMF8, Q9UIR3
Gene ID:
Human(51733) Summary: This gene encodes a protein that belongs to the CN hydrolase family. Beta-ureidopropionase catalyzes the last step in the pyrimidine degradation pathway. The pyrimidine bases uracil and thymine are degraded via the consecutive action of dihydropyrimidine dehydrogenase (DHPDH), dihydropyrimidinase (DHP) and beta-ureidopropionase (UP) to beta-alanine and beta-aminoisobutyric acid, respectively. UP deficiencies are associated with N-carbamyl-beta-amino aciduria and may lead to abnormalities in neurological activity. [provided by RefSeq, Jul 2008]
Mouse(103149) ureidopropionase, beta
Rat(116593) ureidopropionase, beta
Zebrafish(322660) ureidopropionase, beta
dog(486398) ureidopropionase, beta
domestic cat(101081004) ureidopropionase, beta
Horse(100053177) ureidopropionase, beta
chicken(416949) ureidopropionase, beta
cow(504557) ureidopropionase, beta
sheep(101119507) ureidopropionase, beta
domestic guinea pig(100724141) ureidopropionase, beta
naked mole-rat(101718416) ureidopropionase, beta
Domestic Rabbit(100357276) ureidopropionase, beta
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133995 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133995 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133995 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016327 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016327 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016327 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016327 Rosetta Predictions human pricing
NM_053845 Rosetta Predictions rat pricing
NM_133995 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349274 predicted 794
2 SASI_Hs01_00088704 predicted 1120
3 SASI_Hs01_00088706 predicted 743
4 SASI_Hs01_00088707 predicted 525
5 SASI_Hs01_00088708 predicted 607
6 SASI_Hs01_00088710 predicted 832
7 SASI_Hs01_00088711 predicted 991
8 SASI_Hs01_00088712 predicted 649
9 SASI_Hs01_00088713 predicted 942
10 SASI_Hs02_00349275 predicted 935
11 SASI_Hs01_00088705 predicted 571
12 SASI_Hs01_00088709 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053845 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059835 predicted 435
2 SASI_Rn01_00059836 predicted 1055
3 SASI_Rn01_00059837 predicted 779
4 SASI_Rn01_00059838 predicted 1148
5 SASI_Rn01_00059839 predicted 393
6 SASI_Rn01_00059840 predicted 1077
7 SASI_Rn01_00059841 predicted 500
8 SASI_Rn01_00059842 predicted 658
9 SASI_Rn01_00059843 predicted 1169
10 SASI_Rn02_00266696 predicted 840
11 SASI_Rn01_00059844 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133995 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091665 predicted 1151
2 SASI_Mm01_00091666 predicted 386
3 SASI_Mm01_00091667 predicted 652
4 SASI_Mm01_00091668 predicted 772
5 SASI_Mm01_00091669 predicted 743
6 SASI_Mm01_00091670 predicted 1168
7 SASI_Mm01_00091671 predicted 1072
8 SASI_Mm01_00091672 predicted 860
9 SASI_Mm01_00091673 predicted 498
10 SASI_Mm01_00091674 predicted 637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133995
VALIDATED
UPB1 MISSION shRNA Bacterial Glycerol Stock
ureidopropionase, beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133995.1-707s1c1
Sequence:CCGGGCAGGATTGCAGTGAACATTTCTCGAGAAATGTTCACTGCAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133995.1-1080s1c1
Sequence:CCGGCAATGATTTCTGGACTTTCAACTCGAGTTGAAAGTCCAGAAATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133995.1-1077s1c1
Sequence:CCGGGATCAATGATTTCTGGACTTTCTCGAGAAAGTCCAGAAATCATTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133995.1-359s1c1
Sequence:CCGGGTGGAGTCAATATCATCTGTTCTCGAGAACAGATGATATTGACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133995.1-1290s1c1
Sequence:CCGGGAGGGTAGAATAGGCACTTAACTCGAGTTAAGTGCCTATTCTACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133995
VALIDATED
UPB1 MISSION shRNA shRNA Plasmid DNA
ureidopropionase, beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133995.1-707s1c1
Sequence:CCGGGCAGGATTGCAGTGAACATTTCTCGAGAAATGTTCACTGCAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133995.1-1080s1c1
Sequence:CCGGCAATGATTTCTGGACTTTCAACTCGAGTTGAAAGTCCAGAAATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133995.1-1077s1c1
Sequence:CCGGGATCAATGATTTCTGGACTTTCTCGAGAAAGTCCAGAAATCATTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133995.1-359s1c1
Sequence:CCGGGTGGAGTCAATATCATCTGTTCTCGAGAACAGATGATATTGACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133995.1-1290s1c1
Sequence:CCGGGAGGGTAGAATAGGCACTTAACTCGAGTTAAGTGCCTATTCTACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133995
VALIDATED
UPB1 MISSION shRNA Lentiviral Transduction Particles
ureidopropionase, beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133995.1-707s1c1
Sequence:CCGGGCAGGATTGCAGTGAACATTTCTCGAGAAATGTTCACTGCAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133995.1-1080s1c1
Sequence:CCGGCAATGATTTCTGGACTTTCAACTCGAGTTGAAAGTCCAGAAATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133995.1-1077s1c1
Sequence:CCGGGATCAATGATTTCTGGACTTTCTCGAGAAAGTCCAGAAATCATTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133995.1-359s1c1
Sequence:CCGGGTGGAGTCAATATCATCTGTTCTCGAGAACAGATGATATTGACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133995.1-1290s1c1
Sequence:CCGGGAGGGTAGAATAGGCACTTAACTCGAGTTAAGTGCCTATTCTACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016327
UPB1 MISSION shRNA Bacterial Glycerol Stock
ureidopropionase, beta
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016327.1-352s1c1
Sequence:CCGGAGACGCATAAAGGCTATCGTACTCGAGTACGATAGCCTTTATGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016327.1-1110s1c1
Sequence:CCGGGAATGATGTCTGGAACTTCAACTCGAGTTGAAGTTCCAGACATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016327.1-139s1c1
Sequence:CCGGCGCGTTCTCTATGGCAAGGAACTCGAGTTCCTTGCCATAGAGAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016327.1-675s1c1
Sequence:CCGGCAACGAGTCAACTTACTACATCTCGAGATGTAGTAAGTTGACTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016327.1-1072s1c1
Sequence:CCGGCTAGTTGCTAAGCTCGACCTACTCGAGTAGGTCGAGCTTAGCAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016327.2-996s21c1
Sequence:CCGGAGCACTTCCCGAACGAGTTTACTCGAGTAAACTCGTTCGGGAAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016327.2-1488s21c1
Sequence:CCGGGTAGAGGTGAATGTACTAAATCTCGAGATTTAGTACATTCACCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016327
UPB1 MISSION shRNA shRNA Plasmid DNA
ureidopropionase, beta
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016327.1-352s1c1
Sequence:CCGGAGACGCATAAAGGCTATCGTACTCGAGTACGATAGCCTTTATGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016327.1-1110s1c1
Sequence:CCGGGAATGATGTCTGGAACTTCAACTCGAGTTGAAGTTCCAGACATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016327.1-139s1c1
Sequence:CCGGCGCGTTCTCTATGGCAAGGAACTCGAGTTCCTTGCCATAGAGAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016327.1-675s1c1
Sequence:CCGGCAACGAGTCAACTTACTACATCTCGAGATGTAGTAAGTTGACTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016327.1-1072s1c1
Sequence:CCGGCTAGTTGCTAAGCTCGACCTACTCGAGTAGGTCGAGCTTAGCAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016327.2-996s21c1
Sequence:CCGGAGCACTTCCCGAACGAGTTTACTCGAGTAAACTCGTTCGGGAAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016327.2-1488s21c1
Sequence:CCGGGTAGAGGTGAATGTACTAAATCTCGAGATTTAGTACATTCACCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016327
UPB1 MISSION shRNA Lentiviral Transduction Particles
ureidopropionase, beta
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016327.1-352s1c1
Sequence:CCGGAGACGCATAAAGGCTATCGTACTCGAGTACGATAGCCTTTATGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016327.1-1110s1c1
Sequence:CCGGGAATGATGTCTGGAACTTCAACTCGAGTTGAAGTTCCAGACATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016327.1-139s1c1
Sequence:CCGGCGCGTTCTCTATGGCAAGGAACTCGAGTTCCTTGCCATAGAGAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016327.1-675s1c1
Sequence:CCGGCAACGAGTCAACTTACTACATCTCGAGATGTAGTAAGTTGACTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016327.1-1072s1c1
Sequence:CCGGCTAGTTGCTAAGCTCGACCTACTCGAGTAGGTCGAGCTTAGCAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016327.2-996s21c1
Sequence:CCGGAGCACTTCCCGAACGAGTTTACTCGAGTAAACTCGTTCGGGAAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016327.2-1488s21c1
Sequence:CCGGGTAGAGGTGAATGTACTAAATCTCGAGATTTAGTACATTCACCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks