EMAIL THIS PAGE TO A FRIEND

UPF1

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms: HUPF1 NORF1 RENT1 pNORF1 smg-2
UniProtKB ID: Q92900, O00239, O43343, Q86Z25, Q92842
Gene ID:
Human(5976) Summary: This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. [provided by RefSeq, Jul 2008]
Mouse(19704) UPF1 regulator of nonsense transcripts homolog (yeast)
Rat(684558) UPF1 regulator of nonsense transcripts homolog (yeast)
fruit fly(32153) CG1559 gene product from transcript CG1559-RA
chicken(420119) UPF1 regulator of nonsense transcripts homolog (yeast)
dog(476664) UPF1 regulator of nonsense transcripts homolog (yeast)
Horse(100071059) UPF1 regulator of nonsense transcripts homolog (yeast)
domestic cat(101096043) UPF1 regulator of nonsense transcripts homolog (yeast)
Zebrafish(406783) upf1 regulator of nonsense transcripts homolog (yeast)
naked mole-rat(101704366) UPF1 regulator of nonsense transcripts homolog (yeast)
domestic guinea pig(100713813) UPF1 regulator of nonsense transcripts homolog (yeast)
cow(532933) UPF1 regulator of nonsense transcripts homolog (yeast)
sheep(101107598) UPF1 regulator of nonsense transcripts homolog (yeast)
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305873 ANTI-RENT1 (N-TERM E22) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1305874 ANTI-RENT1(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA020857 Anti-UPF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunohistochemistry pricing
HPA019587 Anti-UPF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2102655 Anti-UPF1 antibody produced in rabbit affinity isolated antibody bovine, zebrafish, horse, canine, human, mouse, guinea pig
western blot pricing
SAB4502620 Anti-UPF1 antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
PLA0010 Goat anti-RENT1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. dog, horse, rat, chicken, zebrafish, toad, turkey, mouse, toad, human, bovine, guinea pig
proximity ligation assay, western blot pricing
SAB1402893 Monoclonal Anti-UPF1 antibody produced in mouse clone 4G3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0223 Rabbit anti-RENT1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, zebrafish, toad, bovine, horse, rat, human, chicken, guinea pig, turkey, pig, toad, dog
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002911 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030680 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030680 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030680 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002911 Rosetta Predictions human pricing
XM_001070971 Rosetta Predictions rat pricing
NM_001122829 Rosetta Predictions mouse pricing
NM_030680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101017 predicted 1348
2 SASI_Hs01_00101018 predicted 2455
3 SASI_Hs01_00101019 predicted 3143
4 SASI_Hs01_00101020 predicted 2867
5 SASI_Hs01_00101021 predicted 1421
6 SASI_Hs01_00101022 predicted 1299
7 SASI_Hs01_00101023 predicted 2536
8 SASI_Hs01_00101024 predicted 2085
9 SASI_Hs01_00101025 predicted 1237
10 SASI_Hs02_00334724 predicted 2063
11 SASI_Hs01_00101016 predicted 1494
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333468 predicted 2085
2 SASI_Rn02_00333469 predicted 1439
3 SASI_Rn02_00333470 predicted 2168
4 SASI_Rn02_00333471 predicted 1415
5 SASI_Rn02_00333472 predicted 2821
6 SASI_Rn02_00333473 predicted 1425
7 SASI_Rn02_00333474 predicted 3540
8 SASI_Rn02_00333475 predicted 675
9 SASI_Rn02_00333476 predicted 1356
10 SASI_Rn02_00333477 predicted 3073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309459 predicted 2189
2 SASI_Mm02_00309460 predicted 2051
3 SASI_Mm02_00309461 predicted 2492
4 SASI_Mm02_00309462 predicted 2439
5 SASI_Mm02_00309463 predicted 729
6 SASI_Mm02_00309464 predicted 2521
7 SASI_Mm02_00309465 predicted 1726
8 SASI_Mm02_00309466 predicted 3079
9 SASI_Mm02_00309467 predicted 2693
10 SASI_Mm02_00309468 predicted 2109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181776 predicted 2153
2 SASI_Mm02_00336825 predicted 2019
3 SASI_Mm02_00336826 predicted 2457
4 SASI_Mm02_00336827 predicted 2405
5 SASI_Mm02_00336828 predicted 728
6 SASI_Mm01_00181779 predicted 2488
7 SASI_Mm02_00336829 predicted 1690
8 SASI_Mm02_00336830 predicted 3046
9 SASI_Mm01_00181782 predicted 2657
10 SASI_Mm01_00181783 predicted 2083
11 SASI_Mm01_00181774 predicted 1200
12 SASI_Mm01_00181775 predicted 1388
13 SASI_Mm01_00181777 predicted 1331
14 SASI_Mm01_00181778 predicted 3006
15 SASI_Mm01_00181780 predicted 1803
16 SASI_Mm01_00181781 predicted 1414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002911
UPF1 MISSION shRNA Bacterial Glycerol Stock
UPF1 regulator of nonsense transcripts homolog (yeast)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002911.3-3518s21c1
Sequence:CCGGTTACCTTGGTGACGAGTTTAACTCGAGTTAAACTCGTCACCAAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002911.3-1357s21c1
Sequence:CCGGAGATATGCCTGCGGTACAAAGCTCGAGCTTTGTACCGCAGGCATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002911.3-2155s21c1
Sequence:CCGGAGATGCAGTTCCGCTCCATTTCTCGAGAAATGGAGCGGAACTGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002911.3-371s21c1
Sequence:CCGGGTTCGAGTTCACCGACTTTACCTCGAGGTAAAGTCGGTGAACTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002911.2-3632s1c1
Sequence:CCGGGCATCTTATTCTGGGTAATAACTCGAGTTATTACCCAGAATAAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002911.2-2827s1c1
Sequence:CCGGGCAAGGTATGGCGTCATCATTCTCGAGAATGATGACGCCATACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002911.2-2451s1c1
Sequence:CCGGCCAACCCGATAAACCGATGTTCTCGAGAACATCGGTTTATCGGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002911.2-1126s1c1
Sequence:CCGGGCCTACCAGTACCAGAACATACTCGAGTATGTTCTGGTACTGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002911.2-532s1c1
Sequence:CCGGGCTGAGTTGAACTTCGAGGAACTCGAGTTCCTCGAAGTTCAACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002911
UPF1 MISSION shRNA shRNA Plasmid DNA
UPF1 regulator of nonsense transcripts homolog (yeast)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002911.3-3518s21c1
Sequence:CCGGTTACCTTGGTGACGAGTTTAACTCGAGTTAAACTCGTCACCAAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002911.3-1357s21c1
Sequence:CCGGAGATATGCCTGCGGTACAAAGCTCGAGCTTTGTACCGCAGGCATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002911.3-2155s21c1
Sequence:CCGGAGATGCAGTTCCGCTCCATTTCTCGAGAAATGGAGCGGAACTGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002911.3-371s21c1
Sequence:CCGGGTTCGAGTTCACCGACTTTACCTCGAGGTAAAGTCGGTGAACTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002911.2-3632s1c1
Sequence:CCGGGCATCTTATTCTGGGTAATAACTCGAGTTATTACCCAGAATAAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002911.2-2827s1c1
Sequence:CCGGGCAAGGTATGGCGTCATCATTCTCGAGAATGATGACGCCATACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002911.2-2451s1c1
Sequence:CCGGCCAACCCGATAAACCGATGTTCTCGAGAACATCGGTTTATCGGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002911.2-1126s1c1
Sequence:CCGGGCCTACCAGTACCAGAACATACTCGAGTATGTTCTGGTACTGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002911.2-532s1c1
Sequence:CCGGGCTGAGTTGAACTTCGAGGAACTCGAGTTCCTCGAAGTTCAACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002911
UPF1 MISSION shRNA Lentiviral Transduction Particles
UPF1 regulator of nonsense transcripts homolog (yeast)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002911.3-3518s21c1
Sequence:CCGGTTACCTTGGTGACGAGTTTAACTCGAGTTAAACTCGTCACCAAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002911.3-1357s21c1
Sequence:CCGGAGATATGCCTGCGGTACAAAGCTCGAGCTTTGTACCGCAGGCATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002911.3-2155s21c1
Sequence:CCGGAGATGCAGTTCCGCTCCATTTCTCGAGAAATGGAGCGGAACTGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002911.3-371s21c1
Sequence:CCGGGTTCGAGTTCACCGACTTTACCTCGAGGTAAAGTCGGTGAACTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002911.2-3632s1c1
Sequence:CCGGGCATCTTATTCTGGGTAATAACTCGAGTTATTACCCAGAATAAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002911.2-2827s1c1
Sequence:CCGGGCAAGGTATGGCGTCATCATTCTCGAGAATGATGACGCCATACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002911.2-2451s1c1
Sequence:CCGGCCAACCCGATAAACCGATGTTCTCGAGAACATCGGTTTATCGGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002911.2-1126s1c1
Sequence:CCGGGCCTACCAGTACCAGAACATACTCGAGTATGTTCTGGTACTGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002911.2-532s1c1
Sequence:CCGGGCTGAGTTGAACTTCGAGGAACTCGAGTTCCTCGAAGTTCAACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030680
VALIDATED
UPF1 MISSION shRNA Bacterial Glycerol Stock
UPF1 regulator of nonsense transcripts homolog (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030680.2-3644s21c1
Sequence:CCGGAGCTATGTGGCTTAGTCTATCCTCGAGGATAGACTAAGCCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030680.2-3194s21c1
Sequence:CCGGGCTGCCATGAACATCCCTATTCTCGAGAATAGGGATGTTCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030680.2-2573s21c1
Sequence:CCGGGCAGCCAATGTGGAGAAGATACTCGAGTATCTTCTCCACATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030680.2-660s21c1
Sequence:CCGGCCTGCGTGGTTTACTGTAATACTCGAGTATTACAGTAAACCACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030680.1-4176s1c1
Sequence:CCGGCCCTTCAAAGATTCTTTCAAACTCGAGTTTGAAAGAATCTTTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030680.1-3183s1c1
Sequence:CCGGGCTGCCATGAACATCCCTATTCTCGAGAATAGGGATGTTCATGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030680.1-1761s1c1
Sequence:CCGGGCCACTATTGTCTACCACCTTCTCGAGAAGGTGGTAGACAATAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030680.1-649s1c1
Sequence:CCGGCCTGCGTGGTTTACTGTAATACTCGAGTATTACAGTAAACCACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030680.1-2562s1c1
Sequence:CCGGGCAGCCAATGTGGAGAAGATACTCGAGTATCTTCTCCACATTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030680
VALIDATED
UPF1 MISSION shRNA shRNA Plasmid DNA
UPF1 regulator of nonsense transcripts homolog (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030680.2-3644s21c1
Sequence:CCGGAGCTATGTGGCTTAGTCTATCCTCGAGGATAGACTAAGCCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030680.2-3194s21c1
Sequence:CCGGGCTGCCATGAACATCCCTATTCTCGAGAATAGGGATGTTCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030680.2-2573s21c1
Sequence:CCGGGCAGCCAATGTGGAGAAGATACTCGAGTATCTTCTCCACATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030680.2-660s21c1
Sequence:CCGGCCTGCGTGGTTTACTGTAATACTCGAGTATTACAGTAAACCACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030680.1-4176s1c1
Sequence:CCGGCCCTTCAAAGATTCTTTCAAACTCGAGTTTGAAAGAATCTTTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030680.1-3183s1c1
Sequence:CCGGGCTGCCATGAACATCCCTATTCTCGAGAATAGGGATGTTCATGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030680.1-1761s1c1
Sequence:CCGGGCCACTATTGTCTACCACCTTCTCGAGAAGGTGGTAGACAATAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030680.1-649s1c1
Sequence:CCGGCCTGCGTGGTTTACTGTAATACTCGAGTATTACAGTAAACCACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030680.1-2562s1c1
Sequence:CCGGGCAGCCAATGTGGAGAAGATACTCGAGTATCTTCTCCACATTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030680
VALIDATED
UPF1 MISSION shRNA Lentiviral Transduction Particles
UPF1 regulator of nonsense transcripts homolog (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030680.2-3644s21c1
Sequence:CCGGAGCTATGTGGCTTAGTCTATCCTCGAGGATAGACTAAGCCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030680.2-3194s21c1
Sequence:CCGGGCTGCCATGAACATCCCTATTCTCGAGAATAGGGATGTTCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030680.2-2573s21c1
Sequence:CCGGGCAGCCAATGTGGAGAAGATACTCGAGTATCTTCTCCACATTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030680.2-660s21c1
Sequence:CCGGCCTGCGTGGTTTACTGTAATACTCGAGTATTACAGTAAACCACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030680.1-4176s1c1
Sequence:CCGGCCCTTCAAAGATTCTTTCAAACTCGAGTTTGAAAGAATCTTTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030680.1-3183s1c1
Sequence:CCGGGCTGCCATGAACATCCCTATTCTCGAGAATAGGGATGTTCATGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030680.1-1761s1c1
Sequence:CCGGGCCACTATTGTCTACCACCTTCTCGAGAAGGTGGTAGACAATAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030680.1-649s1c1
Sequence:CCGGCCTGCGTGGTTTACTGTAATACTCGAGTATTACAGTAAACCACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030680.1-2562s1c1
Sequence:CCGGGCAGCCAATGTGGAGAAGATACTCGAGTATCTTCTCCACATTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks