EMAIL THIS PAGE TO A FRIEND

UPF2

UPF2 regulator of nonsense transcripts homolog (yeast)

Synonyms: HUPF2 RENT2 smg-3
Gene ID:
Human(26019) Summary: This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located in the perinuclear area. It interacts with translation release factors and the proteins that are functional homologs of yeast Upf1p and Upf3p. Two splice variants have been found for this gene; both variants encode the same protein. [provided by RefSeq, Jul 2008]
Mouse(326622) UPF2 regulator of nonsense transcripts homolog (yeast)
Rat(361271) UPF2 regulator of nonsense transcripts homolog (yeast)
cow(781181) UPF2 regulator of nonsense transcripts homolog (yeast)
sheep(101116751) UPF2 regulator of nonsense transcripts homolog (yeast)
domestic guinea pig(100734921) UPF2 regulator of nonsense transcripts homolog (yeast)
naked mole-rat(101707612) UPF2 regulator of nonsense transcripts homolog (yeast)
Domestic Rabbit(100354055) UPF2 regulator of nonsense transcripts homolog (yeast)
fruit fly(31724) CG2253 gene product from transcript CG2253-RA
Zebrafish(569006) UPF2 regulator of nonsense transcripts homolog (yeast)
chicken(419100) UPF2 regulator of nonsense transcripts homolog (yeast)
Horse(100069342) UPF2 regulator of nonsense transcripts homolog (yeast)
domestic cat(101085899) UPF2 regulator of nonsense transcripts homolog (yeast)
dog(487130) UPF2 regulator of nonsense transcripts homolog (yeast)
160 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015542 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015542 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015542 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081132 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081132 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081132 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015542 Rosetta Predictions human pricing
NM_080599 Rosetta Predictions human pricing
NM_001108421 Rosetta Predictions rat pricing
NM_001081132 Rosetta Predictions mouse pricing
XM_140801 Rosetta Predictions mouse pricing
XM_898407 Rosetta Predictions mouse pricing
XM_898420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015542 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154914 predicted 846
2 SASI_Hs02_00348069 predicted 2009
3 SASI_Hs01_00154915 predicted 973
4 SASI_Hs01_00154916 predicted 2617
5 SASI_Hs02_00348070 predicted 3947
6 SASI_Hs01_00154919 predicted 3790
7 SASI_Hs01_00154920 predicted 2623
8 SASI_Hs01_00154921 predicted 2423
9 SASI_Hs01_00154922 predicted 2644
10 SASI_Hs01_00154923 predicted 1601
11 SASI_Hs01_00154917 predicted 1263
12 SASI_Hs01_00154918 predicted 1592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172926 predicted 911
2 SASI_Hs02_00362335 predicted 2064
3 SASI_Hs01_00172927 predicted 1031
4 SASI_Hs01_00172928 predicted 2670
5 SASI_Hs02_00362336 predicted 4003
6 SASI_Hs01_00172931 predicted 3844
7 SASI_Hs01_00172932 predicted 2681
8 SASI_Hs01_00172933 predicted 2482
9 SASI_Hs01_00172934 predicted 2703
10 SASI_Hs01_00172935 predicted 1662
11 SASI_Hs01_00172929 predicted 1320
12 SASI_Hs01_00172930 predicted 1649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238469 predicted 1274
2 SASI_Rn02_00238470 predicted 1023
3 SASI_Rn02_00238471 predicted 2433
4 SASI_Rn02_00238472 predicted 2165
5 SASI_Rn02_00238473 predicted 2685
6 SASI_Rn02_00238474 predicted 1532
7 SASI_Rn02_00238475 predicted 3033
8 SASI_Rn02_00238476 predicted 4009
9 SASI_Rn02_00238477 predicted 2768
10 SASI_Rn02_00238478 predicted 2565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295501 predicted 3663
2 SASI_Mm02_00295502 predicted 1702
3 SASI_Mm02_00295503 predicted 1249
4 SASI_Mm02_00295504 predicted 2135
5 SASI_Mm02_00295505 predicted 2317
6 SASI_Mm02_00295506 predicted 3010
7 SASI_Mm02_00295507 predicted 1629
8 SASI_Mm02_00295508 predicted 1176
9 SASI_Mm02_00295509 predicted 3997
10 SASI_Mm02_00295510 predicted 3739
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_140801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241837 predicted 3667
2 SASI_Mm01_00241838 predicted 1260
3 SASI_Mm01_00241839 predicted 2145
4 SASI_Mm01_00241840 predicted 2669
5 SASI_Mm01_00241841 predicted 2326
6 SASI_Mm01_00241842 predicted 3052
7 SASI_Mm01_00241843 predicted 3021
8 SASI_Mm01_00241844 predicted 1635
9 SASI_Mm01_00241845 predicted 3734
10 SASI_Mm01_00241846 predicted 3994
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233201 predicted 3668
2 SASI_Mm01_00233202 predicted 1255
3 SASI_Mm01_00233203 predicted 2149
4 SASI_Mm01_00233204 predicted 2677
5 SASI_Mm01_00233205 predicted 2321
6 SASI_Mm01_00233206 predicted 3965
7 SASI_Mm01_00233207 predicted 3983
8 SASI_Mm01_00233208 predicted 3022
9 SASI_Mm01_00233209 predicted 1628
10 SASI_Mm01_00233210 predicted 3734
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232182 predicted 4221
2 SASI_Mm01_00232183 predicted 1810
3 SASI_Mm01_00232184 predicted 2697
4 SASI_Mm01_00232185 predicted 3225
5 SASI_Mm01_00232186 predicted 2886
6 SASI_Mm01_00232187 predicted 3613
7 SASI_Mm01_00232188 predicted 3577
8 SASI_Mm01_00232189 predicted 2191
9 SASI_Mm01_00232190 predicted 4298
10 SASI_Mm01_00232191 predicted 4551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015542
VALIDATED
UPF2 MISSION shRNA Bacterial Glycerol Stock
UPF2 regulator of nonsense transcripts homolog (yeast)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015542.2-3479s1c1
Sequence:CCGGCACCAACTAGATGTTGCCATTCTCGAGAATGGCAACATCTAGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015542.2-2923s1c1
Sequence:CCGGGCGTTATGTTTGGTGGAAGAACTCGAGTTCTTCCACCAAACATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015542.2-2153s1c1
Sequence:CCGGGACTTCTCTCATCACCATATTCTCGAGAATATGGTGATGAGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015542.2-1628s1c1
Sequence:CCGGGAACTTGAGTTGGAGAATCTACTCGAGTAGATTCTCCAACTCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015542.2-1035s1c1
Sequence:CCGGGACTTGTACCAAGGAAAGTAACTCGAGTTACTTTCCTTGGTACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015542.2-4124s1c1
Sequence:CCGGCGCGAGGGTTAATCTTCTCTTCTCGAGAAGAGAAGATTAACCCTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015542.2-3478s1c1
Sequence:CCGGGCACCAACTAGATGTTGCCATCTCGAGATGGCAACATCTAGTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015542.2-2923s21c1
Sequence:CCGGGCGTTATGTTTGGTGGAAGAACTCGAGTTCTTCCACCAAACATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015542.2-1606s1c1
Sequence:CCGGGGTATCAAGTCCCGATGATTTCTCGAGAAATCATCGGGACTTGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015542.2-4526s1c1
Sequence:CCGGCATCAGAGTCAGTGCTATAAACTCGAGTTTATAGCACTGACTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015542.2-2297s21c1
Sequence:CCGGGCGAGATACGTCACAATGGTACTCGAGTACCATTGTGACGTATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015542.2-4124s21c1
Sequence:CCGGCGCGAGGGTTAATCTTCTCTTCTCGAGAAGAGAAGATTAACCCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015542.2-2633s21c1
Sequence:CCGGCGATTAGGAATGGAGGTTAATCTCGAGATTAACCTCCATTCCTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015542
VALIDATED
UPF2 MISSION shRNA shRNA Plasmid DNA
UPF2 regulator of nonsense transcripts homolog (yeast)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015542.2-3479s1c1
Sequence:CCGGCACCAACTAGATGTTGCCATTCTCGAGAATGGCAACATCTAGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015542.2-2923s1c1
Sequence:CCGGGCGTTATGTTTGGTGGAAGAACTCGAGTTCTTCCACCAAACATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015542.2-2153s1c1
Sequence:CCGGGACTTCTCTCATCACCATATTCTCGAGAATATGGTGATGAGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015542.2-1628s1c1
Sequence:CCGGGAACTTGAGTTGGAGAATCTACTCGAGTAGATTCTCCAACTCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015542.2-1035s1c1
Sequence:CCGGGACTTGTACCAAGGAAAGTAACTCGAGTTACTTTCCTTGGTACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015542.2-4124s1c1
Sequence:CCGGCGCGAGGGTTAATCTTCTCTTCTCGAGAAGAGAAGATTAACCCTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015542.2-3478s1c1
Sequence:CCGGGCACCAACTAGATGTTGCCATCTCGAGATGGCAACATCTAGTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015542.2-2923s21c1
Sequence:CCGGGCGTTATGTTTGGTGGAAGAACTCGAGTTCTTCCACCAAACATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015542.2-1606s1c1
Sequence:CCGGGGTATCAAGTCCCGATGATTTCTCGAGAAATCATCGGGACTTGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015542.2-4526s1c1
Sequence:CCGGCATCAGAGTCAGTGCTATAAACTCGAGTTTATAGCACTGACTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015542.2-2297s21c1
Sequence:CCGGGCGAGATACGTCACAATGGTACTCGAGTACCATTGTGACGTATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015542.2-4124s21c1
Sequence:CCGGCGCGAGGGTTAATCTTCTCTTCTCGAGAAGAGAAGATTAACCCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015542.2-2633s21c1
Sequence:CCGGCGATTAGGAATGGAGGTTAATCTCGAGATTAACCTCCATTCCTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015542
VALIDATED
UPF2 MISSION shRNA Lentiviral Transduction Particles
UPF2 regulator of nonsense transcripts homolog (yeast)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015542.2-3479s1c1
Sequence:CCGGCACCAACTAGATGTTGCCATTCTCGAGAATGGCAACATCTAGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015542.2-2923s1c1
Sequence:CCGGGCGTTATGTTTGGTGGAAGAACTCGAGTTCTTCCACCAAACATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015542.2-2153s1c1
Sequence:CCGGGACTTCTCTCATCACCATATTCTCGAGAATATGGTGATGAGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015542.2-1628s1c1
Sequence:CCGGGAACTTGAGTTGGAGAATCTACTCGAGTAGATTCTCCAACTCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015542.2-1035s1c1
Sequence:CCGGGACTTGTACCAAGGAAAGTAACTCGAGTTACTTTCCTTGGTACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015542.2-4124s1c1
Sequence:CCGGCGCGAGGGTTAATCTTCTCTTCTCGAGAAGAGAAGATTAACCCTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015542.2-3478s1c1
Sequence:CCGGGCACCAACTAGATGTTGCCATCTCGAGATGGCAACATCTAGTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015542.2-2923s21c1
Sequence:CCGGGCGTTATGTTTGGTGGAAGAACTCGAGTTCTTCCACCAAACATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015542.2-1606s1c1
Sequence:CCGGGGTATCAAGTCCCGATGATTTCTCGAGAAATCATCGGGACTTGATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015542.2-4526s1c1
Sequence:CCGGCATCAGAGTCAGTGCTATAAACTCGAGTTTATAGCACTGACTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015542.2-2297s21c1
Sequence:CCGGGCGAGATACGTCACAATGGTACTCGAGTACCATTGTGACGTATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015542.2-4124s21c1
Sequence:CCGGCGCGAGGGTTAATCTTCTCTTCTCGAGAAGAGAAGATTAACCCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015542.2-2633s21c1
Sequence:CCGGCGATTAGGAATGGAGGTTAATCTCGAGATTAACCTCCATTCCTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081132
UPF2 MISSION shRNA Bacterial Glycerol Stock
UPF2 regulator of nonsense transcripts homolog (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081132.1-586s21c1
Sequence:CCGGCCGCCTAGATTCGAGCTTAAACTCGAGTTTAAGCTCGAATCTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081132.1-4018s21c1
Sequence:CCGGCTAGAGAGTTGCGAATCTAAACTCGAGTTTAGATTCGCAACTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081132.1-2877s21c1
Sequence:CCGGATACCTGTGGCCAGTACTTTGCTCGAGCAAAGTACTGGCCACAGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081132.1-3865s21c1
Sequence:CCGGAGCACCTAATGCAGATCTAATCTCGAGATTAGATCTGCATTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081132.1-1244s21c1
Sequence:CCGGAGGCGTATTCTGCACTCTAAACTCGAGTTTAGAGTGCAGAATACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081132
UPF2 MISSION shRNA shRNA Plasmid DNA
UPF2 regulator of nonsense transcripts homolog (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081132.1-586s21c1
Sequence:CCGGCCGCCTAGATTCGAGCTTAAACTCGAGTTTAAGCTCGAATCTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081132.1-4018s21c1
Sequence:CCGGCTAGAGAGTTGCGAATCTAAACTCGAGTTTAGATTCGCAACTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081132.1-2877s21c1
Sequence:CCGGATACCTGTGGCCAGTACTTTGCTCGAGCAAAGTACTGGCCACAGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081132.1-3865s21c1
Sequence:CCGGAGCACCTAATGCAGATCTAATCTCGAGATTAGATCTGCATTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081132.1-1244s21c1
Sequence:CCGGAGGCGTATTCTGCACTCTAAACTCGAGTTTAGAGTGCAGAATACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081132
UPF2 MISSION shRNA Lentiviral Transduction Particles
UPF2 regulator of nonsense transcripts homolog (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081132.1-586s21c1
Sequence:CCGGCCGCCTAGATTCGAGCTTAAACTCGAGTTTAAGCTCGAATCTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081132.1-4018s21c1
Sequence:CCGGCTAGAGAGTTGCGAATCTAAACTCGAGTTTAGATTCGCAACTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081132.1-2877s21c1
Sequence:CCGGATACCTGTGGCCAGTACTTTGCTCGAGCAAAGTACTGGCCACAGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081132.1-3865s21c1
Sequence:CCGGAGCACCTAATGCAGATCTAATCTCGAGATTAGATCTGCATTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081132.1-1244s21c1
Sequence:CCGGAGGCGTATTCTGCACTCTAAACTCGAGTTTAGAGTGCAGAATACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks