EMAIL THIS PAGE TO A FRIEND

UPF3A

UPF3 regulator of nonsense transcripts homolog A (yeast)

Synonyms: HUPF3A RENT3A UPF3
Gene ID:
Human(65110) Summary: This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. The encoded protein is one of two functional homologs to yeast Upf3p. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. It forms with Y14 a complex that binds specifically 20 nt upstream of exon-exon junctions. This gene is located on the long arm of chromosome 13. Two splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(67031) UPF3 regulator of nonsense transcripts homolog A (yeast)
Rat(361176) UPF3 regulator of nonsense transcripts homolog A (yeast)
Zebrafish(566608) UPF3 regulator of nonsense transcripts homolog A (yeast)
chicken(418734) UPF3 regulator of nonsense transcripts homolog A (yeast)
dog(607836) UPF3 regulator of nonsense transcripts homolog A (yeast)
domestic cat(101099267) UPF3 regulator of nonsense transcripts homolog A (yeast)
naked mole-rat(101724600) UPF3 regulator of nonsense transcripts homolog A (yeast)
domestic guinea pig(100724694) UPF3 regulator of nonsense transcripts homolog A (yeast)
cow(529442) UPF3 regulator of nonsense transcripts homolog A (yeast)
sheep(101121945) UPF3 regulator of nonsense transcripts homolog A (yeast)
121 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023011 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023011 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023011 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023011 Rosetta Predictions human pricing
NM_080687 Rosetta Predictions human pricing
NM_001012159 Rosetta Predictions rat pricing
XM_573945 Rosetta Predictions rat pricing
NM_025924 Rosetta Predictions mouse pricing
XM_356061 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356278 predicted 1798
2 SASI_Hs01_00082693 predicted 1488
3 SASI_Hs02_00356279 predicted 1950
4 SASI_Hs01_00082694 predicted 1602
5 SASI_Hs01_00082696 predicted 1626
6 SASI_Hs01_00082697 predicted 1857
7 SASI_Hs01_00082698 predicted 1672
8 SASI_Hs01_00082699 predicted 1599
9 SASI_Hs01_00082700 predicted 1758
10 SASI_Hs01_00082701 predicted 1811
11 SASI_Hs01_00082695 predicted 1079
12 SASI_Hs01_00082702 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362478 predicted 1692
2 SASI_Hs01_00210479 predicted 1392
3 SASI_Hs02_00362479 predicted 1846
4 SASI_Hs01_00210480 predicted 1507
5 SASI_Hs01_00210482 predicted 1525
6 SASI_Hs01_00210483 predicted 1758
7 SASI_Hs01_00210484 predicted 1581
8 SASI_Hs01_00210485 predicted 1497
9 SASI_Hs01_00210486 predicted 1658
10 SASI_Hs01_00210487 predicted 1708
11 SASI_Hs01_00210481 predicted 976
12 SASI_Hs01_00210488 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012159 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054938 predicted 414
2 SASI_Rn01_00054939 predicted 412
3 SASI_Rn01_00054940 predicted 290
4 SASI_Rn01_00054941 predicted 1229
5 SASI_Rn01_00054942 predicted 1008
6 SASI_Rn01_00054943 predicted 1092
7 SASI_Rn01_00054944 predicted 464
8 SASI_Rn01_00054945 predicted 1249
9 SASI_Rn01_00054946 predicted 1142
10 SASI_Rn01_00054947 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573945 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00165797 predicted 461
2 SASI_Rn01_00165798 predicted 463
3 SASI_Rn01_00165799 predicted 338
4 SASI_Rn01_00165800 predicted 1280
5 SASI_Rn01_00165801 predicted 1058
6 SASI_Rn01_00165802 predicted 1149
7 SASI_Rn01_00165803 predicted 512
8 SASI_Rn01_00165804 predicted 1304
9 SASI_Rn01_00165805 predicted 1186
10 SASI_Rn01_00165806 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329276 predicted 552
2 SASI_Mm02_00329277 predicted 1089
3 SASI_Mm02_00329278 predicted 572
4 SASI_Mm02_00329279 predicted 562
5 SASI_Mm02_00329280 predicted 377
6 SASI_Mm02_00329281 predicted 487
7 SASI_Mm02_00329282 predicted 1146
8 SASI_Mm02_00329283 predicted 1150
9 SASI_Mm02_00329284 predicted 389
10 SASI_Mm02_00329285 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_356061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274821 predicted 1275
2 SASI_Mm01_00274822 predicted 520
3 SASI_Mm01_00274823 predicted 1039
4 SASI_Mm01_00274824 predicted 1090
5 SASI_Mm01_00274825 predicted 1293
6 SASI_Mm01_00274826 predicted 405
7 SASI_Mm01_00274827 predicted 446
8 SASI_Mm01_00274828 predicted 1208
9 SASI_Mm01_00274829 predicted 414
10 SASI_Mm01_00274830 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023011
UPF3A MISSION shRNA Bacterial Glycerol Stock
UPF3 regulator of nonsense transcripts homolog A (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023011.2-1076s21c1
Sequence:CCGGGATGTGGAGAGATCTCAAGAACTCGAGTTCTTGAGATCTCTCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023011.2-449s21c1
Sequence:CCGGGACAGCAAAGGCCTAGAATATCTCGAGATATTCTAGGCCTTTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023011.2-368s21c1
Sequence:CCGGTACTCAAGAGCATACATTAATCTCGAGATTAATGTATGCTCTTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023011.2-1597s21c1
Sequence:CCGGGACGTAGAAACACGCAGAAACCTCGAGGTTTCTGCGTGTTTCTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023011.2-871s21c1
Sequence:CCGGAGTAAGGATTAAGCTTCTTAACTCGAGTTAAGAAGCTTAATCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023011.2-668s1c1
Sequence:CCGGGCTAGAAGAACCACACCTCTTCTCGAGAAGAGGTGTGGTTCTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183367    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023011.2-1610s1c1
Sequence:CCGGGCAGAAACCATTCTAAAGAAACTCGAGTTTCTTTAGAATGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023011.2-491s1c1
Sequence:CCGGCCATTCCAGAAGATAGCCAAACTCGAGTTTGGCTATCTTCTGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023011.2-546s1c1
Sequence:CCGGGCATCGAAGATGATCCAGAATCTCGAGATTCTGGATCATCTTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023011.2-1076s1c1
Sequence:CCGGGATGTGGAGAGATCTCAAGAACTCGAGTTCTTGAGATCTCTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023011
UPF3A MISSION shRNA shRNA Plasmid DNA
UPF3 regulator of nonsense transcripts homolog A (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023011.2-1076s21c1
Sequence:CCGGGATGTGGAGAGATCTCAAGAACTCGAGTTCTTGAGATCTCTCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023011.2-449s21c1
Sequence:CCGGGACAGCAAAGGCCTAGAATATCTCGAGATATTCTAGGCCTTTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023011.2-368s21c1
Sequence:CCGGTACTCAAGAGCATACATTAATCTCGAGATTAATGTATGCTCTTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023011.2-1597s21c1
Sequence:CCGGGACGTAGAAACACGCAGAAACCTCGAGGTTTCTGCGTGTTTCTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023011.2-871s21c1
Sequence:CCGGAGTAAGGATTAAGCTTCTTAACTCGAGTTAAGAAGCTTAATCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023011.2-668s1c1
Sequence:CCGGGCTAGAAGAACCACACCTCTTCTCGAGAAGAGGTGTGGTTCTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183367    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023011.2-1610s1c1
Sequence:CCGGGCAGAAACCATTCTAAAGAAACTCGAGTTTCTTTAGAATGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023011.2-491s1c1
Sequence:CCGGCCATTCCAGAAGATAGCCAAACTCGAGTTTGGCTATCTTCTGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023011.2-546s1c1
Sequence:CCGGGCATCGAAGATGATCCAGAATCTCGAGATTCTGGATCATCTTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023011.2-1076s1c1
Sequence:CCGGGATGTGGAGAGATCTCAAGAACTCGAGTTCTTGAGATCTCTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023011
UPF3A MISSION shRNA Lentiviral Transduction Particles
UPF3 regulator of nonsense transcripts homolog A (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023011.2-1076s21c1
Sequence:CCGGGATGTGGAGAGATCTCAAGAACTCGAGTTCTTGAGATCTCTCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023011.2-449s21c1
Sequence:CCGGGACAGCAAAGGCCTAGAATATCTCGAGATATTCTAGGCCTTTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023011.2-368s21c1
Sequence:CCGGTACTCAAGAGCATACATTAATCTCGAGATTAATGTATGCTCTTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023011.2-1597s21c1
Sequence:CCGGGACGTAGAAACACGCAGAAACCTCGAGGTTTCTGCGTGTTTCTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023011.2-871s21c1
Sequence:CCGGAGTAAGGATTAAGCTTCTTAACTCGAGTTAAGAAGCTTAATCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023011.2-668s1c1
Sequence:CCGGGCTAGAAGAACCACACCTCTTCTCGAGAAGAGGTGTGGTTCTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183367    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023011.2-1610s1c1
Sequence:CCGGGCAGAAACCATTCTAAAGAAACTCGAGTTTCTTTAGAATGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023011.2-491s1c1
Sequence:CCGGCCATTCCAGAAGATAGCCAAACTCGAGTTTGGCTATCTTCTGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023011.2-546s1c1
Sequence:CCGGGCATCGAAGATGATCCAGAATCTCGAGATTCTGGATCATCTTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023011.2-1076s1c1
Sequence:CCGGGATGTGGAGAGATCTCAAGAACTCGAGTTCTTGAGATCTCTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025924
VALIDATED
UPF3A MISSION shRNA Bacterial Glycerol Stock
UPF3 regulator of nonsense transcripts homolog A (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025924.2-894s21c1
Sequence:CCGGCGTGAGGATCAAGCTTCTTAACTCGAGTTAAGAAGCTTGATCCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025924.2-577s21c1
Sequence:CCGGGAAGATGACCCAGAATATAAACTCGAGTTTATATTCTGGGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025924.2-455s21c1
Sequence:CCGGTTGACGGCTATATCTTCATTGCTCGAGCAATGAAGATATAGCCGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025924.2-396s21c1
Sequence:CCGGCTCCAGAGCATACATTAATTTCTCGAGAAATTAATGTATGCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025924.2-1041s21c1
Sequence:CCGGGCTACAGGATACCAGTGATAACTCGAGTTATCACTGGTATCCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025924
VALIDATED
UPF3A MISSION shRNA shRNA Plasmid DNA
UPF3 regulator of nonsense transcripts homolog A (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025924.2-894s21c1
Sequence:CCGGCGTGAGGATCAAGCTTCTTAACTCGAGTTAAGAAGCTTGATCCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025924.2-577s21c1
Sequence:CCGGGAAGATGACCCAGAATATAAACTCGAGTTTATATTCTGGGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025924.2-455s21c1
Sequence:CCGGTTGACGGCTATATCTTCATTGCTCGAGCAATGAAGATATAGCCGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025924.2-396s21c1
Sequence:CCGGCTCCAGAGCATACATTAATTTCTCGAGAAATTAATGTATGCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025924.2-1041s21c1
Sequence:CCGGGCTACAGGATACCAGTGATAACTCGAGTTATCACTGGTATCCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025924
VALIDATED
UPF3A MISSION shRNA Lentiviral Transduction Particles
UPF3 regulator of nonsense transcripts homolog A (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025924.2-894s21c1
Sequence:CCGGCGTGAGGATCAAGCTTCTTAACTCGAGTTAAGAAGCTTGATCCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025924.2-577s21c1
Sequence:CCGGGAAGATGACCCAGAATATAAACTCGAGTTTATATTCTGGGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025924.2-455s21c1
Sequence:CCGGTTGACGGCTATATCTTCATTGCTCGAGCAATGAAGATATAGCCGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025924.2-396s21c1
Sequence:CCGGCTCCAGAGCATACATTAATTTCTCGAGAAATTAATGTATGCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025924.2-1041s21c1
Sequence:CCGGGCTACAGGATACCAGTGATAACTCGAGTTATCACTGGTATCCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks