EMAIL THIS PAGE TO A FRIEND

UPF3B

UPF3 regulator of nonsense transcripts homolog B (yeast)

Synonyms: HUPF3B MRXS14 RENT3B UPF3X
UniProtKB ID: Q9BZI7, D3DWI3, D3DWI4, Q0VAK8, Q9H1J0
Gene ID:
Human(65109) Summary: This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. The encoded protein is one of two functional homologs to yeast Upf3p. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. It forms with Y14 a complex that binds specifically 20 nt upstream of exon-exon junctions. This gene is located on the long arm of chromosome X. Two splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(68134) UPF3 regulator of nonsense transcripts homolog B (yeast)
Rat(313449) UPF3 regulator of nonsense transcripts homolog B (yeast)
Zebrafish(393929) UPF3 regulator of nonsense transcripts homolog B (yeast)
chicken(100858231) UPF3 regulator of nonsense transcripts homolog B (yeast)
dog(481031) UPF3 regulator of nonsense transcripts homolog B (yeast)
domestic cat(101084940) UPF3 regulator of nonsense transcripts homolog B (yeast)
cow(616181) UPF3 regulator of nonsense transcripts homolog B (yeast)
sheep(101101868) UPF3 regulator of nonsense transcripts homolog B (yeast)
naked mole-rat(101700790) UPF3 regulator of nonsense transcripts homolog B (yeast)
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023010 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023010 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023010 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026573 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026573 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026573 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023010 Rosetta Predictions human pricing
NM_080632 Rosetta Predictions human pricing
XM_001058104 Rosetta Predictions rat pricing
XM_233312 Rosetta Predictions rat pricing
NM_026573 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020723 predicted 1778
2 SASI_Hs02_00356274 predicted 1439
3 SASI_Hs01_00020724 predicted 1616
4 SASI_Hs01_00020725 predicted 1910
5 SASI_Hs01_00020726 predicted 1951
6 SASI_Hs01_00020728 predicted 1780
7 SASI_Hs02_00356275 predicted 1830
8 SASI_Hs02_00356276 predicted 1439
9 SASI_Hs01_00020730 predicted 1928
10 SASI_Hs02_00356277 predicted 1953
11 SASI_Hs01_00020721 predicted 1906
12 SASI_Hs01_00020722 predicted 416
13 SASI_Hs01_00020727 predicted 337
14 SASI_Hs01_00020729 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173558 predicted 1818
2 SASI_Hs02_00362380 predicted 1484
3 SASI_Hs01_00173559 predicted 1660
4 SASI_Hs01_00173560 predicted 1943
5 SASI_Hs01_00173561 predicted 1990
6 SASI_Hs01_00173563 predicted 1821
7 SASI_Hs02_00362381 predicted 1873
8 SASI_Hs02_00362382 predicted 1485
9 SASI_Hs01_00173565 predicted 1972
10 SASI_Hs02_00362383 predicted 1992
11 SASI_Hs01_00173556 predicted 1939
12 SASI_Hs01_00173557 predicted 411
13 SASI_Hs01_00173562 predicted 342
14 SASI_Hs01_00173564 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288604 predicted 2024
2 SASI_Rn02_00288605 predicted 1659
3 SASI_Rn02_00288606 predicted 252
4 SASI_Rn02_00288607 predicted 446
5 SASI_Rn02_00288608 predicted 1938
6 SASI_Rn02_00288609 predicted 364
7 SASI_Rn02_00288610 predicted 1897
8 SASI_Rn02_00288611 predicted 1805
9 SASI_Rn02_00288612 predicted 447
10 SASI_Rn02_00288613 predicted 1969
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387652 predicted 2022
2 SASI_Rn02_00387653 predicted 1659
3 SASI_Rn02_00387654 predicted 247
4 SASI_Rn02_00387655 predicted 439
5 SASI_Rn02_00387656 predicted 1936
6 SASI_Rn02_00387657 predicted 370
7 SASI_Rn02_00387658 predicted 1902
8 SASI_Rn02_00387659 predicted 1798
9 SASI_Rn02_00387660 predicted 450
10 SASI_Rn02_00387661 predicted 1965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330525 predicted 349
2 SASI_Mm02_00330526 predicted 231
3 SASI_Mm02_00330527 predicted 1677
4 SASI_Mm02_00330528 predicted 1834
5 SASI_Mm02_00330529 predicted 1948
6 SASI_Mm02_00330530 predicted 1930
7 SASI_Mm02_00330531 predicted 1700
8 SASI_Mm02_00330532 predicted 448
9 SASI_Mm02_00330533 predicted 1952
10 SASI_Mm02_00330534 predicted 1710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023010
VALIDATED
UPF3B MISSION shRNA Bacterial Glycerol Stock
UPF3 regulator of nonsense transcripts homolog B (yeast)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154179    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023010.2-1567s1c1
Sequence:CCGGCAGGGCAAAGAATAGAGAGAACTCGAGTTCTCTCTATTCTTTGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023010.2-1890s1c1
Sequence:CCGGGAAGCCTTGTTCCGATCTAATCTCGAGATTAGATCGGAACAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023010.2-229s1c1
Sequence:CCGGGCAAGGTGGTAATTCGAAGATCTCGAGATCTTCGAATTACCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023010.2-360s1c1
Sequence:CCGGGCCAGAGCATACATCAACTTTCTCGAGAAAGTTGATGTATGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023010.2-411s1c1
Sequence:CCGGGATCGCTTTGATGGTTATGTACTCGAGTACATAACCATCAAAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023010.2-2175s1c1
Sequence:CCGGCCTTGTTTGACTCTTGACAATCTCGAGATTGTCAAGAGTCAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023010.2-230s1c1
Sequence:CCGGCAAGGTGGTAATTCGAAGATTCTCGAGAATCTTCGAATTACCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023010.2-2091s1c1
Sequence:CCGGGCTTATATGAGCTTAGCGTAACTCGAGTTACGCTAAGCTCATATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_023010.2-1007s1c1
Sequence:CCGGGCGTTCTGATAGCGAACTTAACTCGAGTTAAGTTCGCTATCAGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023010.2-1083s1c1
Sequence:CCGGGAACGGGAATATGAACGAGATCTCGAGATCTCGTTCATATTCCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023010.2-294s1c1
Sequence:CCGGCCTATGCCTGAGCATGATTATCTCGAGATAATCATGCTCAGGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023010.2-517s1c1
Sequence:CCGGGAGATACCAAAGTCGGGACTACTCGAGTAGTCCCGACTTTGGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023010
VALIDATED
UPF3B MISSION shRNA shRNA Plasmid DNA
UPF3 regulator of nonsense transcripts homolog B (yeast)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154179    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023010.2-1567s1c1
Sequence:CCGGCAGGGCAAAGAATAGAGAGAACTCGAGTTCTCTCTATTCTTTGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023010.2-1890s1c1
Sequence:CCGGGAAGCCTTGTTCCGATCTAATCTCGAGATTAGATCGGAACAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023010.2-229s1c1
Sequence:CCGGGCAAGGTGGTAATTCGAAGATCTCGAGATCTTCGAATTACCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023010.2-360s1c1
Sequence:CCGGGCCAGAGCATACATCAACTTTCTCGAGAAAGTTGATGTATGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023010.2-411s1c1
Sequence:CCGGGATCGCTTTGATGGTTATGTACTCGAGTACATAACCATCAAAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023010.2-2175s1c1
Sequence:CCGGCCTTGTTTGACTCTTGACAATCTCGAGATTGTCAAGAGTCAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023010.2-230s1c1
Sequence:CCGGCAAGGTGGTAATTCGAAGATTCTCGAGAATCTTCGAATTACCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023010.2-2091s1c1
Sequence:CCGGGCTTATATGAGCTTAGCGTAACTCGAGTTACGCTAAGCTCATATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_023010.2-1007s1c1
Sequence:CCGGGCGTTCTGATAGCGAACTTAACTCGAGTTAAGTTCGCTATCAGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023010.2-1083s1c1
Sequence:CCGGGAACGGGAATATGAACGAGATCTCGAGATCTCGTTCATATTCCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023010.2-294s1c1
Sequence:CCGGCCTATGCCTGAGCATGATTATCTCGAGATAATCATGCTCAGGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023010.2-517s1c1
Sequence:CCGGGAGATACCAAAGTCGGGACTACTCGAGTAGTCCCGACTTTGGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023010
VALIDATED
UPF3B MISSION shRNA Lentiviral Transduction Particles
UPF3 regulator of nonsense transcripts homolog B (yeast)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154179    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023010.2-1567s1c1
Sequence:CCGGCAGGGCAAAGAATAGAGAGAACTCGAGTTCTCTCTATTCTTTGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023010.2-1890s1c1
Sequence:CCGGGAAGCCTTGTTCCGATCTAATCTCGAGATTAGATCGGAACAAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023010.2-229s1c1
Sequence:CCGGGCAAGGTGGTAATTCGAAGATCTCGAGATCTTCGAATTACCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023010.2-360s1c1
Sequence:CCGGGCCAGAGCATACATCAACTTTCTCGAGAAAGTTGATGTATGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023010.2-411s1c1
Sequence:CCGGGATCGCTTTGATGGTTATGTACTCGAGTACATAACCATCAAAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023010.2-2175s1c1
Sequence:CCGGCCTTGTTTGACTCTTGACAATCTCGAGATTGTCAAGAGTCAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023010.2-230s1c1
Sequence:CCGGCAAGGTGGTAATTCGAAGATTCTCGAGAATCTTCGAATTACCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023010.2-2091s1c1
Sequence:CCGGGCTTATATGAGCTTAGCGTAACTCGAGTTACGCTAAGCTCATATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_023010.2-1007s1c1
Sequence:CCGGGCGTTCTGATAGCGAACTTAACTCGAGTTAAGTTCGCTATCAGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023010.2-1083s1c1
Sequence:CCGGGAACGGGAATATGAACGAGATCTCGAGATCTCGTTCATATTCCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023010.2-294s1c1
Sequence:CCGGCCTATGCCTGAGCATGATTATCTCGAGATAATCATGCTCAGGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023010.2-517s1c1
Sequence:CCGGGAGATACCAAAGTCGGGACTACTCGAGTAGTCCCGACTTTGGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026573
VALIDATED
UPF3B MISSION shRNA Bacterial Glycerol Stock
UPF3 regulator of nonsense transcripts homolog B (yeast)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026573.1-1550s1c1
Sequence:CCGGGCAGCCAAAGAGCACGTATTACTCGAGTAATACGTGCTCTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026573.1-703s1c1
Sequence:CCGGCCTGAAGAACAAGCAAAGAATCTCGAGATTCTTTGCTTGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026573.1-441s1c1
Sequence:CCGGGCTATGTATTCCTTGACAATACTCGAGTATTGTCAAGGAATACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026573.1-637s1c1
Sequence:CCGGGCTGGAGGAAATTGAAGCCAACTCGAGTTGGCTTCAATTTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026573.1-239s1c1
Sequence:CCGGGCTTTGAGCAAGGTGGTAATTCTCGAGAATTACCACCTTGCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026573.2-236s21c1
Sequence:CCGGGCTTTGAGCAAGGTGGTAATTCTCGAGAATTACCACCTTGCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026573.2-1547s21c1
Sequence:CCGGGCAGCCAAAGAGCACGTATTACTCGAGTAATACGTGCTCTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026573.2-309s21c1
Sequence:CCGGCTATGCCTGAGCACGATTATTCTCGAGAATAATCGTGCTCAGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026573.2-438s21c1
Sequence:CCGGGCTATGTATTCCTTGACAATACTCGAGTATTGTCAAGGAATACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026573.2-700s21c1
Sequence:CCGGCCTGAAGAACAAGCAAAGAATCTCGAGATTCTTTGCTTGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026573
VALIDATED
UPF3B MISSION shRNA shRNA Plasmid DNA
UPF3 regulator of nonsense transcripts homolog B (yeast)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026573.1-1550s1c1
Sequence:CCGGGCAGCCAAAGAGCACGTATTACTCGAGTAATACGTGCTCTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026573.1-703s1c1
Sequence:CCGGCCTGAAGAACAAGCAAAGAATCTCGAGATTCTTTGCTTGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026573.1-441s1c1
Sequence:CCGGGCTATGTATTCCTTGACAATACTCGAGTATTGTCAAGGAATACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026573.1-637s1c1
Sequence:CCGGGCTGGAGGAAATTGAAGCCAACTCGAGTTGGCTTCAATTTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026573.1-239s1c1
Sequence:CCGGGCTTTGAGCAAGGTGGTAATTCTCGAGAATTACCACCTTGCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026573.2-236s21c1
Sequence:CCGGGCTTTGAGCAAGGTGGTAATTCTCGAGAATTACCACCTTGCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026573.2-1547s21c1
Sequence:CCGGGCAGCCAAAGAGCACGTATTACTCGAGTAATACGTGCTCTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026573.2-309s21c1
Sequence:CCGGCTATGCCTGAGCACGATTATTCTCGAGAATAATCGTGCTCAGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026573.2-438s21c1
Sequence:CCGGGCTATGTATTCCTTGACAATACTCGAGTATTGTCAAGGAATACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026573.2-700s21c1
Sequence:CCGGCCTGAAGAACAAGCAAAGAATCTCGAGATTCTTTGCTTGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026573
VALIDATED
UPF3B MISSION shRNA Lentiviral Transduction Particles
UPF3 regulator of nonsense transcripts homolog B (yeast)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026573.1-1550s1c1
Sequence:CCGGGCAGCCAAAGAGCACGTATTACTCGAGTAATACGTGCTCTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026573.1-703s1c1
Sequence:CCGGCCTGAAGAACAAGCAAAGAATCTCGAGATTCTTTGCTTGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026573.1-441s1c1
Sequence:CCGGGCTATGTATTCCTTGACAATACTCGAGTATTGTCAAGGAATACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026573.1-637s1c1
Sequence:CCGGGCTGGAGGAAATTGAAGCCAACTCGAGTTGGCTTCAATTTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026573.1-239s1c1
Sequence:CCGGGCTTTGAGCAAGGTGGTAATTCTCGAGAATTACCACCTTGCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026573.2-236s21c1
Sequence:CCGGGCTTTGAGCAAGGTGGTAATTCTCGAGAATTACCACCTTGCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026573.2-1547s21c1
Sequence:CCGGGCAGCCAAAGAGCACGTATTACTCGAGTAATACGTGCTCTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026573.2-309s21c1
Sequence:CCGGCTATGCCTGAGCACGATTATTCTCGAGAATAATCGTGCTCAGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026573.2-438s21c1
Sequence:CCGGGCTATGTATTCCTTGACAATACTCGAGTATTGTCAAGGAATACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026573.2-700s21c1
Sequence:CCGGCCTGAAGAACAAGCAAAGAATCTCGAGATTCTTTGCTTGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks