EMAIL THIS PAGE TO A FRIEND

UPK1A

uroplakin 1A

Synonyms: TSPAN21 UP1A UPIA UPKA
UniProtKB ID: O00322, Q3KNU5, Q3KNU6
Gene ID:
Human(11045) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is found in the asymmetrical unit membrane (AUM) where it can complex with other transmembrane 4 superfamily proteins. It may play a role in normal bladder epithelial physiology, possibly in regulating membrane permeability of superficial umbrella cells or in stabilizing the apical membrane through AUM/cytoskeletal interactions. [provided by RefSeq, Jul 2008]
Mouse(109637) uroplakin 1A
Rat(365227) uroplakin 1A
cow(282112) uroplakin 1A
sheep(101117956) uroplakin 1A
Zebrafish(678515) uroplakin 1a
dog(484579) uroplakin 1A
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007000 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007000 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007000 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026815 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026815 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026815 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007000 Rosetta Predictions human pricing
NM_001108911 Rosetta Predictions rat pricing
NM_026815 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185614 predicted 493
2 SASI_Hs01_00185616 predicted 377
3 SASI_Hs01_00185617 predicted 264
4 SASI_Hs01_00185619 predicted 731
5 SASI_Hs02_00342748 predicted 386
6 SASI_Hs01_00185621 predicted 746
7 SASI_Hs02_00342749 predicted 288
8 SASI_Hs02_00342750 predicted 564
9 SASI_Hs02_00342751 predicted 694
10 SASI_Hs02_00342752 predicted 892
11 SASI_Hs01_00185612 predicted 369
12 SASI_Hs01_00185613 predicted 887
13 SASI_Hs01_00185615 predicted 358
14 SASI_Hs01_00185618 predicted 744
15 SASI_Hs01_00185620 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243305 predicted 665
2 SASI_Rn02_00243306 predicted 608
3 SASI_Rn02_00243307 predicted 667
4 SASI_Rn02_00243308 predicted 297
5 SASI_Rn02_00243309 predicted 839
6 SASI_Rn02_00243310 predicted 286
7 SASI_Rn02_00243311 predicted 780
8 SASI_Rn02_00243312 predicted 602
9 SASI_Rn02_00243313 predicted 649
10 SASI_Rn02_00243314 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026815 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160428 predicted 408
2 SASI_Mm01_00160429 predicted 477
3 SASI_Mm01_00160430 predicted 400
4 SASI_Mm01_00160431 predicted 718
5 SASI_Mm01_00160432 predicted 895
6 SASI_Mm01_00160433 predicted 679
7 SASI_Mm01_00160434 predicted 291
8 SASI_Mm01_00160435 predicted 200
9 SASI_Mm01_00160436 predicted 638
10 SASI_Mm01_00160437 predicted 315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007000
UPK1A MISSION shRNA Bacterial Glycerol Stock
uroplakin 1A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007000.2-695s21c1
Sequence:GTACCGGGTATCTCGTGGTTTGGGTTTGCTCGAGCAAACCCAAACCACGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007000.2-623s21c1
Sequence:GTACCGGGGCACATGGACTACCTGTTCACTCGAGTGAACAGGTAGTCCATGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007000.2-892s21c1
Sequence:GTACCGGTTACGTCCTTCCACTTCCAAGCTCGAGCTTGGAAGTGGAAGGACGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007000.2-645s21c1
Sequence:GTACCGGCAAGGGCTGCTTCGAACACATCTCGAGATGTGTTCGAAGCAGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007000.2-456s21c1
Sequence:GTACCGGCGTCATGATTGAGCAAGAATGCTCGAGCATTCTTGCTCAATCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007000.2-369s21c1
Sequence:GTACCGGCAACCCATCCCTGATCACCAACTCGAGTTGGTGATCAGGGATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007000.2-970s1c1
Sequence:CCGGGCTTGTGTGCACATATCCTTACTCGAGTAAGGATATGTGCACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007000.2-455s1c1
Sequence:CCGGGCGTCATGATTGAGCAAGAATCTCGAGATTCTTGCTCAATCATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007000.2-54s1c1
Sequence:CCGGCCTGCTAGTTGTGGGCAATATCTCGAGATATTGCCCACAACTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007000.2-898s1c1
Sequence:CCGGCCTTCCACTTCCAAGATCTTTCTCGAGAAAGATCTTGGAAGTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007000.2-57s1c1
Sequence:CCGGGCTAGTTGTGGGCAATATCATCTCGAGATGATATTGCCCACAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007000.2-219s1c1
Sequence:CCGGCTTCTTCATGGTAGCCAGTTTCTCGAGAAACTGGCTACCATGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007000
UPK1A MISSION shRNA shRNA Plasmid DNA
uroplakin 1A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007000.2-695s21c1
Sequence:GTACCGGGTATCTCGTGGTTTGGGTTTGCTCGAGCAAACCCAAACCACGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007000.2-623s21c1
Sequence:GTACCGGGGCACATGGACTACCTGTTCACTCGAGTGAACAGGTAGTCCATGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007000.2-892s21c1
Sequence:GTACCGGTTACGTCCTTCCACTTCCAAGCTCGAGCTTGGAAGTGGAAGGACGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007000.2-645s21c1
Sequence:GTACCGGCAAGGGCTGCTTCGAACACATCTCGAGATGTGTTCGAAGCAGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007000.2-456s21c1
Sequence:GTACCGGCGTCATGATTGAGCAAGAATGCTCGAGCATTCTTGCTCAATCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007000.2-369s21c1
Sequence:GTACCGGCAACCCATCCCTGATCACCAACTCGAGTTGGTGATCAGGGATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007000.2-970s1c1
Sequence:CCGGGCTTGTGTGCACATATCCTTACTCGAGTAAGGATATGTGCACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007000.2-455s1c1
Sequence:CCGGGCGTCATGATTGAGCAAGAATCTCGAGATTCTTGCTCAATCATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007000.2-54s1c1
Sequence:CCGGCCTGCTAGTTGTGGGCAATATCTCGAGATATTGCCCACAACTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007000.2-898s1c1
Sequence:CCGGCCTTCCACTTCCAAGATCTTTCTCGAGAAAGATCTTGGAAGTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007000.2-57s1c1
Sequence:CCGGGCTAGTTGTGGGCAATATCATCTCGAGATGATATTGCCCACAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007000.2-219s1c1
Sequence:CCGGCTTCTTCATGGTAGCCAGTTTCTCGAGAAACTGGCTACCATGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007000
UPK1A MISSION shRNA Lentiviral Transduction Particles
uroplakin 1A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007000.2-695s21c1
Sequence:GTACCGGGTATCTCGTGGTTTGGGTTTGCTCGAGCAAACCCAAACCACGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007000.2-623s21c1
Sequence:GTACCGGGGCACATGGACTACCTGTTCACTCGAGTGAACAGGTAGTCCATGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007000.2-892s21c1
Sequence:GTACCGGTTACGTCCTTCCACTTCCAAGCTCGAGCTTGGAAGTGGAAGGACGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007000.2-645s21c1
Sequence:GTACCGGCAAGGGCTGCTTCGAACACATCTCGAGATGTGTTCGAAGCAGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007000.2-456s21c1
Sequence:GTACCGGCGTCATGATTGAGCAAGAATGCTCGAGCATTCTTGCTCAATCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007000.2-369s21c1
Sequence:GTACCGGCAACCCATCCCTGATCACCAACTCGAGTTGGTGATCAGGGATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007000.2-970s1c1
Sequence:CCGGGCTTGTGTGCACATATCCTTACTCGAGTAAGGATATGTGCACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007000.2-455s1c1
Sequence:CCGGGCGTCATGATTGAGCAAGAATCTCGAGATTCTTGCTCAATCATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007000.2-54s1c1
Sequence:CCGGCCTGCTAGTTGTGGGCAATATCTCGAGATATTGCCCACAACTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007000.2-898s1c1
Sequence:CCGGCCTTCCACTTCCAAGATCTTTCTCGAGAAAGATCTTGGAAGTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007000.2-57s1c1
Sequence:CCGGGCTAGTTGTGGGCAATATCATCTCGAGATGATATTGCCCACAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007000.2-219s1c1
Sequence:CCGGCTTCTTCATGGTAGCCAGTTTCTCGAGAAACTGGCTACCATGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026815
VALIDATED
UPK1A MISSION shRNA Bacterial Glycerol Stock
uroplakin 1A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026815.2-85s21c1
Sequence:CCGGGGTCGTGGGCAACATCATTATCTCGAGATAATGATGTTGCCCACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026815.2-367s21c1
Sequence:CCGGCTACACCCACCGCGACTATATCTCGAGATATAGTCGCGGTGGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026815.2-1125s21c1
Sequence:CCGGCCGAACTGTGGCTTCCATAACCTCGAGGTTATGGAAGCCACAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026815.2-518s21c1
Sequence:CCGGCCCATGGACTGGGTGAATTACCTCGAGGTAATTCACCCAGTCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026815.2-765s21c1
Sequence:CCGGTGATGTTGATAGCCATGTATTCTCGAGAATACATGGCTATCAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026815.1-765s1c1
Sequence:CCGGGTGATGTTGATAGCCATGTATCTCGAGATACATGGCTATCAACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175249    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026815.1-1069s1c1
Sequence:CCGGCAACAACATATCTTGTCCTTACTCGAGTAAGGACAAGATATGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026815
VALIDATED
UPK1A MISSION shRNA shRNA Plasmid DNA
uroplakin 1A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026815.2-85s21c1
Sequence:CCGGGGTCGTGGGCAACATCATTATCTCGAGATAATGATGTTGCCCACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026815.2-367s21c1
Sequence:CCGGCTACACCCACCGCGACTATATCTCGAGATATAGTCGCGGTGGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026815.2-1125s21c1
Sequence:CCGGCCGAACTGTGGCTTCCATAACCTCGAGGTTATGGAAGCCACAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026815.2-518s21c1
Sequence:CCGGCCCATGGACTGGGTGAATTACCTCGAGGTAATTCACCCAGTCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026815.2-765s21c1
Sequence:CCGGTGATGTTGATAGCCATGTATTCTCGAGAATACATGGCTATCAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026815.1-765s1c1
Sequence:CCGGGTGATGTTGATAGCCATGTATCTCGAGATACATGGCTATCAACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175249    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026815.1-1069s1c1
Sequence:CCGGCAACAACATATCTTGTCCTTACTCGAGTAAGGACAAGATATGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026815
VALIDATED
UPK1A MISSION shRNA Lentiviral Transduction Particles
uroplakin 1A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026815.2-85s21c1
Sequence:CCGGGGTCGTGGGCAACATCATTATCTCGAGATAATGATGTTGCCCACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026815.2-367s21c1
Sequence:CCGGCTACACCCACCGCGACTATATCTCGAGATATAGTCGCGGTGGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026815.2-1125s21c1
Sequence:CCGGCCGAACTGTGGCTTCCATAACCTCGAGGTTATGGAAGCCACAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026815.2-518s21c1
Sequence:CCGGCCCATGGACTGGGTGAATTACCTCGAGGTAATTCACCCAGTCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026815.2-765s21c1
Sequence:CCGGTGATGTTGATAGCCATGTATTCTCGAGAATACATGGCTATCAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026815.1-765s1c1
Sequence:CCGGGTGATGTTGATAGCCATGTATCTCGAGATACATGGCTATCAACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175249    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026815.1-1069s1c1
Sequence:CCGGCAACAACATATCTTGTCCTTACTCGAGTAAGGACAAGATATGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks