EMAIL THIS PAGE TO A FRIEND

UPK1B

uroplakin 1B

Synonyms: TSPAN20 UPIB UPK1
UniProtKB ID: O75841, O60753, Q9UIM2, Q9UNX6
Gene ID:
Human(7348) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is found in the asymmetrical unit membrane (AUM) where it can form a complex with other transmembrane 4 superfamily proteins. It may play a role in normal bladder epithelial physiology, possibly in regulating membrane permeability of superficial umbrella cells or in stabilizing the apical membrane through AUM/cytoskeletal interactions. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(22268) uroplakin 1B
Rat(303924) uroplakin 1B
chicken(418345) uroplakin 1B
dog(608131) uroplakin 1B
cow(282113) uroplakin 1B
sheep(101104704) uroplakin 1B
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006952 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006952 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006952 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006952 Rosetta Predictions human pricing
NM_001024253 Rosetta Predictions rat pricing
NM_178924 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097678 predicted 552
2 SASI_Hs01_00097679 predicted 930
3 SASI_Hs01_00097680 predicted 854
4 SASI_Hs01_00097681 predicted 555
5 SASI_Hs01_00097682 predicted 961
6 SASI_Hs01_00097683 predicted 747
7 SASI_Hs01_00097684 predicted 959
8 SASI_Hs01_00097685 predicted 653
9 SASI_Hs01_00097686 predicted 455
10 SASI_Hs01_00097687 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051404 predicted 544
2 SASI_Rn01_00051405 predicted 399
3 SASI_Rn01_00051406 predicted 744
4 SASI_Rn01_00051407 predicted 497
5 SASI_Rn01_00051408 predicted 755
6 SASI_Rn01_00051409 predicted 193
7 SASI_Rn02_00202413 predicted 246
8 SASI_Rn01_00051410 predicted 623
9 SASI_Rn01_00051412 predicted 695
10 SASI_Rn01_00051413 predicted 319
11 SASI_Rn01_00051411 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069835 predicted 215
2 SASI_Mm02_00349549 predicted 1091
3 SASI_Mm01_00069837 predicted 344
4 SASI_Mm01_00069839 predicted 289
5 SASI_Mm02_00349550 predicted 1055
6 SASI_Mm02_00349551 predicted 1130
7 SASI_Mm02_00349552 predicted 415
8 SASI_Mm02_00349553 predicted 991
9 SASI_Mm02_00349554 predicted 1120
10 SASI_Mm02_00349555 predicted 1090
11 SASI_Mm01_00069832 predicted 1242
12 SASI_Mm01_00069833 predicted 652
13 SASI_Mm01_00069834 predicted 564
14 SASI_Mm01_00069836 predicted 477
15 SASI_Mm01_00069838 predicted 522
16 SASI_Mm01_00069840 predicted 1187
17 SASI_Mm01_00069841 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006952
UPK1B MISSION shRNA Bacterial Glycerol Stock
uroplakin 1B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006952.3-647s1c1
Sequence:CCGGGCCTCGTCAATGCTGTGTTATCTCGAGATAACACAGCATTGACGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006952.3-1468s1c1
Sequence:CCGGGTAGCCTCAATTCTCCATTAACTCGAGTTAATGGAGAATTGAGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006952.3-1265s1c1
Sequence:CCGGGCTTCTGTTGATCTCAGTATTCTCGAGAATACTGAGATCAACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135955    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006952.3-1177s1c1
Sequence:CCGGGAACCTGTGTTATCACAGTAACTCGAGTTACTGTGATAACACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006952.3-1225s1c1
Sequence:CCGGGCCTGTATCTCTCACTATTATCTCGAGATAATAGTGAGAGATACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006952.3-181s1c1
Sequence:CCGGCGGAGTGCATCTTCTTTGTATCTCGAGATACAAAGAAGATGCACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006952.3-1256s1c1
Sequence:CCGGCCTTCCAATGCTTCTGTTGATCTCGAGATCAACAGAAGCATTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006952.3-414s1c1
Sequence:CCGGGCAGCAACACAACAAGACTTTCTCGAGAAAGTCTTGTTGTGTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137479    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006952.3-873s1c1
Sequence:CCGGGCATAAAGTGTTGCCACCATACTCGAGTATGGTGGCAACACTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006952.3-963s1c1
Sequence:CCGGCCACACTAACGTGTGTGTCTTCTCGAGAAGACACACACGTTAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006952.3-841s1c1
Sequence:CCGGCCATGTTCTACTGGAGCAGAACTCGAGTTCTGCTCCAGTAGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006952
UPK1B MISSION shRNA shRNA Plasmid DNA
uroplakin 1B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006952.3-647s1c1
Sequence:CCGGGCCTCGTCAATGCTGTGTTATCTCGAGATAACACAGCATTGACGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006952.3-1468s1c1
Sequence:CCGGGTAGCCTCAATTCTCCATTAACTCGAGTTAATGGAGAATTGAGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006952.3-1265s1c1
Sequence:CCGGGCTTCTGTTGATCTCAGTATTCTCGAGAATACTGAGATCAACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135955    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006952.3-1177s1c1
Sequence:CCGGGAACCTGTGTTATCACAGTAACTCGAGTTACTGTGATAACACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006952.3-1225s1c1
Sequence:CCGGGCCTGTATCTCTCACTATTATCTCGAGATAATAGTGAGAGATACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006952.3-181s1c1
Sequence:CCGGCGGAGTGCATCTTCTTTGTATCTCGAGATACAAAGAAGATGCACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006952.3-1256s1c1
Sequence:CCGGCCTTCCAATGCTTCTGTTGATCTCGAGATCAACAGAAGCATTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006952.3-414s1c1
Sequence:CCGGGCAGCAACACAACAAGACTTTCTCGAGAAAGTCTTGTTGTGTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137479    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006952.3-873s1c1
Sequence:CCGGGCATAAAGTGTTGCCACCATACTCGAGTATGGTGGCAACACTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006952.3-963s1c1
Sequence:CCGGCCACACTAACGTGTGTGTCTTCTCGAGAAGACACACACGTTAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006952.3-841s1c1
Sequence:CCGGCCATGTTCTACTGGAGCAGAACTCGAGTTCTGCTCCAGTAGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006952
UPK1B MISSION shRNA Lentiviral Transduction Particles
uroplakin 1B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006952.3-647s1c1
Sequence:CCGGGCCTCGTCAATGCTGTGTTATCTCGAGATAACACAGCATTGACGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006952.3-1468s1c1
Sequence:CCGGGTAGCCTCAATTCTCCATTAACTCGAGTTAATGGAGAATTGAGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006952.3-1265s1c1
Sequence:CCGGGCTTCTGTTGATCTCAGTATTCTCGAGAATACTGAGATCAACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135955    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006952.3-1177s1c1
Sequence:CCGGGAACCTGTGTTATCACAGTAACTCGAGTTACTGTGATAACACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006952.3-1225s1c1
Sequence:CCGGGCCTGTATCTCTCACTATTATCTCGAGATAATAGTGAGAGATACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006952.3-181s1c1
Sequence:CCGGCGGAGTGCATCTTCTTTGTATCTCGAGATACAAAGAAGATGCACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006952.3-1256s1c1
Sequence:CCGGCCTTCCAATGCTTCTGTTGATCTCGAGATCAACAGAAGCATTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006952.3-414s1c1
Sequence:CCGGGCAGCAACACAACAAGACTTTCTCGAGAAAGTCTTGTTGTGTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137479    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006952.3-873s1c1
Sequence:CCGGGCATAAAGTGTTGCCACCATACTCGAGTATGGTGGCAACACTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006952.3-963s1c1
Sequence:CCGGCCACACTAACGTGTGTGTCTTCTCGAGAAGACACACACGTTAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006952.3-841s1c1
Sequence:CCGGCCATGTTCTACTGGAGCAGAACTCGAGTTCTGCTCCAGTAGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178924
UPK1B MISSION shRNA Bacterial Glycerol Stock
uroplakin 1B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178924.2-162s1c1
Sequence:CCGGGACAGCAGAGTGTATCTTCTTCTCGAGAAGAAGATACACTCTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178924.2-167s1c1
Sequence:CCGGCAGAGTGTATCTTCTTTGTATCTCGAGATACAAAGAAGATACACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178924.2-1063s1c1
Sequence:CCGGGCCTAAGATTCCGAAATGTATCTCGAGATACATTTCGGAATCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178924.4-344s21c1
Sequence:CCGGCGTACTTCATCATGATGTTTACTCGAGTAAACATCATGATGAAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178924.4-1135s21c1
Sequence:CCGGGTACTTACGTGTACTATATAACTCGAGTTATATAGTACACGTAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178924.4-298s1c1
Sequence:CCGGCTAGCCATAGTAGGAATTATGCTCGAGCATAATTCCTACTATGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178924.4-646s21c1
Sequence:CCGGTGCGTCATGGACAAGCTTAAACTCGAGTTTAAGCTTGTCCATGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178924.4-297s21c1
Sequence:CCGGTCTAGCCATAGTAGGAATTATCTCGAGATAATTCCTACTATGGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178924
UPK1B MISSION shRNA shRNA Plasmid DNA
uroplakin 1B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178924.2-162s1c1
Sequence:CCGGGACAGCAGAGTGTATCTTCTTCTCGAGAAGAAGATACACTCTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178924.2-167s1c1
Sequence:CCGGCAGAGTGTATCTTCTTTGTATCTCGAGATACAAAGAAGATACACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178924.2-1063s1c1
Sequence:CCGGGCCTAAGATTCCGAAATGTATCTCGAGATACATTTCGGAATCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178924.4-344s21c1
Sequence:CCGGCGTACTTCATCATGATGTTTACTCGAGTAAACATCATGATGAAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178924.4-1135s21c1
Sequence:CCGGGTACTTACGTGTACTATATAACTCGAGTTATATAGTACACGTAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178924.4-298s1c1
Sequence:CCGGCTAGCCATAGTAGGAATTATGCTCGAGCATAATTCCTACTATGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178924.4-646s21c1
Sequence:CCGGTGCGTCATGGACAAGCTTAAACTCGAGTTTAAGCTTGTCCATGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178924.4-297s21c1
Sequence:CCGGTCTAGCCATAGTAGGAATTATCTCGAGATAATTCCTACTATGGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178924
UPK1B MISSION shRNA Lentiviral Transduction Particles
uroplakin 1B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178924.2-162s1c1
Sequence:CCGGGACAGCAGAGTGTATCTTCTTCTCGAGAAGAAGATACACTCTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178924.2-167s1c1
Sequence:CCGGCAGAGTGTATCTTCTTTGTATCTCGAGATACAAAGAAGATACACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178924.2-1063s1c1
Sequence:CCGGGCCTAAGATTCCGAAATGTATCTCGAGATACATTTCGGAATCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178924.4-344s21c1
Sequence:CCGGCGTACTTCATCATGATGTTTACTCGAGTAAACATCATGATGAAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178924.4-1135s21c1
Sequence:CCGGGTACTTACGTGTACTATATAACTCGAGTTATATAGTACACGTAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178924.4-298s1c1
Sequence:CCGGCTAGCCATAGTAGGAATTATGCTCGAGCATAATTCCTACTATGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178924.4-646s21c1
Sequence:CCGGTGCGTCATGGACAAGCTTAAACTCGAGTTTAAGCTTGTCCATGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178924.4-297s21c1
Sequence:CCGGTCTAGCCATAGTAGGAATTATCTCGAGATAATTCCTACTATGGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks