EMAIL THIS PAGE TO A FRIEND

UPK2

uroplakin 2

Synonyms: UP2 UPII
UniProtKB ID: O00526, B0YJ92, O00457, Q53YV0
Gene ID:
Human(7379) Summary: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.[provided by RefSeq, Sep 2009]
Mouse(22269) uroplakin 2
Rat(689093) uroplakin 2
cow(281569) uroplakin 2
sheep(101104600) uroplakin 2
dog(610673) uroplakin 2
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006760 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006760 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006760 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006760 Rosetta Predictions human pricing
NM_001109523 Rosetta Predictions rat pricing
NM_009476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141469 predicted 439
2 SASI_Hs02_00342248 predicted 335
3 SASI_Hs02_00342249 predicted 357
4 SASI_Hs01_00141471 predicted 242
5 SASI_Hs01_00141472 predicted 335
6 SASI_Hs01_00141473 predicted 445
7 SASI_Hs01_00141474 predicted 228
8 SASI_Hs02_00342250 predicted 406
9 SASI_Hs02_00342251 predicted 456
10 SASI_Hs01_00141476 predicted 331
11 SASI_Hs01_00141468 predicted 367
12 SASI_Hs01_00141470 predicted 377
13 SASI_Hs01_00141475 predicted 203
14 SASI_Hs01_00141477 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249239 predicted 483
2 SASI_Rn02_00249240 predicted 483
3 SASI_Rn02_00249241 predicted 389
4 SASI_Rn02_00249242 predicted 356
5 SASI_Rn02_00249243 predicted 468
6 SASI_Rn02_00249244 predicted 259
7 SASI_Rn02_00249245 predicted 253
8 SASI_Rn02_00249246 predicted 220
9 SASI_Rn02_00249247 predicted 521
10 SASI_Rn02_00249248 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316204 predicted 363
2 SASI_Mm02_00316205 predicted 264
3 SASI_Mm01_00101888 predicted 390
4 SASI_Mm01_00101889 predicted 382
5 SASI_Mm01_00101890 predicted 260
6 SASI_Mm01_00101892 predicted 215
7 SASI_Mm01_00101893 predicted 255
8 SASI_Mm02_00316206 predicted 385
9 SASI_Mm02_00316207 predicted 278
10 SASI_Mm02_00316208 predicted 342
11 SASI_Mm01_00101886 predicted 483
12 SASI_Mm01_00101887 predicted 570
13 SASI_Mm01_00101891 predicted 372
14 SASI_Mm01_00101894 predicted 562
15 SASI_Mm01_00101895 predicted 249
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006760
UPK2 MISSION shRNA Bacterial Glycerol Stock
uroplakin 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006760.3-447s21c1
Sequence:CCGGGAGATCCCAATGTCCACACTCCTCGAGGAGTGTGGACATTGGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006760.3-361s21c1
Sequence:CCGGCATACCAGGTGACAAACCTCGCTCGAGCGAGGTTTGTCACCTGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006760.3-240s21c1
Sequence:CCGGCGGAGAGCCAATGACAGCAAACTCGAGTTTGCTGTCATTGGCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006760.1-386s1c1
Sequence:CCGGCATTTCCTACCTAGTGAAGAACTCGAGTTCTTCACTAGGTAGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006760.1-456s1c1
Sequence:CCGGCGAAGGAACATGGAATCCATTCTCGAGAATGGATTCCATGTTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006760.1-368s1c1
Sequence:CCGGGCCAGGAACCAAATTCTACATCTCGAGATGTAGAATTTGGTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006760.1-772s1c1
Sequence:CCGGCACCTTCCAACACTCCATTATCTCGAGATAATGGAGTGTTGGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006760
UPK2 MISSION shRNA shRNA Plasmid DNA
uroplakin 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006760.3-447s21c1
Sequence:CCGGGAGATCCCAATGTCCACACTCCTCGAGGAGTGTGGACATTGGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006760.3-361s21c1
Sequence:CCGGCATACCAGGTGACAAACCTCGCTCGAGCGAGGTTTGTCACCTGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006760.3-240s21c1
Sequence:CCGGCGGAGAGCCAATGACAGCAAACTCGAGTTTGCTGTCATTGGCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006760.1-386s1c1
Sequence:CCGGCATTTCCTACCTAGTGAAGAACTCGAGTTCTTCACTAGGTAGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006760.1-456s1c1
Sequence:CCGGCGAAGGAACATGGAATCCATTCTCGAGAATGGATTCCATGTTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006760.1-368s1c1
Sequence:CCGGGCCAGGAACCAAATTCTACATCTCGAGATGTAGAATTTGGTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006760.1-772s1c1
Sequence:CCGGCACCTTCCAACACTCCATTATCTCGAGATAATGGAGTGTTGGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006760
UPK2 MISSION shRNA Lentiviral Transduction Particles
uroplakin 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006760.3-447s21c1
Sequence:CCGGGAGATCCCAATGTCCACACTCCTCGAGGAGTGTGGACATTGGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006760.3-361s21c1
Sequence:CCGGCATACCAGGTGACAAACCTCGCTCGAGCGAGGTTTGTCACCTGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006760.3-240s21c1
Sequence:CCGGCGGAGAGCCAATGACAGCAAACTCGAGTTTGCTGTCATTGGCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006760.1-386s1c1
Sequence:CCGGCATTTCCTACCTAGTGAAGAACTCGAGTTCTTCACTAGGTAGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006760.1-456s1c1
Sequence:CCGGCGAAGGAACATGGAATCCATTCTCGAGAATGGATTCCATGTTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006760.1-368s1c1
Sequence:CCGGGCCAGGAACCAAATTCTACATCTCGAGATGTAGAATTTGGTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006760.1-772s1c1
Sequence:CCGGCACCTTCCAACACTCCATTATCTCGAGATAATGGAGTGTTGGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009476
UPK2 MISSION shRNA Bacterial Glycerol Stock
uroplakin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009476.1-391s1c1
Sequence:CCGGCAGGAACCAAATACTACATATCTCGAGATATGTAGTATTTGGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009476.1-389s1c1
Sequence:CCGGACCAGGAACCAAATACTACATCTCGAGATGTAGTATTTGGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009476.1-362s1c1
Sequence:CCGGCAGCGCATATCAGGTGACAAACTCGAGTTTGTCACCTGATATGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009476.1-175s1c1
Sequence:CCGGCGCTAACAGAAAGCCTGTTAACTCGAGTTAACAGGCTTTCTGTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009476.1-263s1c1
Sequence:CCGGCAAAGTGGTTAAGTCAGACTTCTCGAGAAGTCTGACTTAACCACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009476
UPK2 MISSION shRNA shRNA Plasmid DNA
uroplakin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009476.1-391s1c1
Sequence:CCGGCAGGAACCAAATACTACATATCTCGAGATATGTAGTATTTGGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009476.1-389s1c1
Sequence:CCGGACCAGGAACCAAATACTACATCTCGAGATGTAGTATTTGGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009476.1-362s1c1
Sequence:CCGGCAGCGCATATCAGGTGACAAACTCGAGTTTGTCACCTGATATGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009476.1-175s1c1
Sequence:CCGGCGCTAACAGAAAGCCTGTTAACTCGAGTTAACAGGCTTTCTGTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009476.1-263s1c1
Sequence:CCGGCAAAGTGGTTAAGTCAGACTTCTCGAGAAGTCTGACTTAACCACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009476
UPK2 MISSION shRNA Lentiviral Transduction Particles
uroplakin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009476.1-391s1c1
Sequence:CCGGCAGGAACCAAATACTACATATCTCGAGATATGTAGTATTTGGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009476.1-389s1c1
Sequence:CCGGACCAGGAACCAAATACTACATCTCGAGATGTAGTATTTGGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009476.1-362s1c1
Sequence:CCGGCAGCGCATATCAGGTGACAAACTCGAGTTTGTCACCTGATATGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009476.1-175s1c1
Sequence:CCGGCGCTAACAGAAAGCCTGTTAACTCGAGTTAACAGGCTTTCTGTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009476.1-263s1c1
Sequence:CCGGCAAAGTGGTTAAGTCAGACTTCTCGAGAAGTCTGACTTAACCACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks