EMAIL THIS PAGE TO A FRIEND

UPK3A

uroplakin 3A

Synonyms: UP3A UPIII UPIIIA UPK3
UniProtKB ID: O75631, B0QY25, O60261, Q32N05, Q5TII6
Gene ID:
Human(7380) Summary: This gene encodes a member of the uroplakin family, a group of transmembrane proteins that form complexes on the apical surface of the bladder epithelium. Mutations in this gene may be associated with renal adysplasia. Alternatively spliced transcript variants have been described.[provided by RefSeq, Nov 2009]
Mouse(22270) uroplakin 3A
Rat(315190) uroplakin 3A
chicken(418242) uroplakin 3A
dog(609118) uroplakin 3A
cow(100336102) uroplakin 3A
sheep(101119631) uroplakin 3A
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006953 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006953 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006953 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU034871 MISSION® esiRNA esiRNA targeting mouse Upk3a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006953 Rosetta Predictions human pricing
NM_001130507 Rosetta Predictions rat pricing
NM_023478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055172 predicted 619
2 SASI_Hs01_00055173 predicted 378
3 SASI_Hs01_00055174 predicted 616
4 SASI_Hs02_00342674 predicted 262
5 SASI_Hs01_00055176 predicted 213
6 SASI_Hs02_00342675 predicted 300
7 SASI_Hs02_00342676 predicted 256
8 SASI_Hs01_00055179 predicted 487
9 SASI_Hs01_00055180 predicted 509
10 SASI_Hs02_00342677 predicted 224
11 SASI_Hs01_00055175 predicted 490
12 SASI_Hs01_00055177 predicted 485
13 SASI_Hs01_00055178 predicted 503
14 SASI_Hs01_00055181 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130507 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255499 predicted 234
2 SASI_Rn02_00255500 predicted 404
3 SASI_Rn02_00255501 predicted 316
4 SASI_Rn02_00255502 predicted 641
5 SASI_Rn02_00255503 predicted 234
6 SASI_Rn02_00255504 predicted 403
7 SASI_Rn02_00255505 predicted 503
8 SASI_Rn02_00255506 predicted 650
9 SASI_Rn02_00255507 predicted 222
10 SASI_Rn02_00255508 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095291 predicted 376
2 SASI_Mm01_00095293 predicted 287
3 SASI_Mm01_00095294 predicted 401
4 SASI_Mm01_00095295 predicted 616
5 SASI_Mm01_00095296 predicted 526
6 SASI_Mm01_00095297 predicted 387
7 SASI_Mm02_00327134 predicted 472
8 SASI_Mm01_00095298 predicted 671
9 SASI_Mm01_00095299 predicted 542
10 SASI_Mm01_00095300 predicted 206
11 SASI_Mm01_00095292 predicted 216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006953
UPK3A MISSION shRNA Bacterial Glycerol Stock
uroplakin 3A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006953.2-498s1c1
Sequence:CCGGCAAGTATGTCCTGGTCAATATCTCGAGATATTGACCAGGACATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006953.2-662s1c1
Sequence:CCGGCCTTCTTTCTACTTGTGGGTTCTCGAGAACCCACAAGTAGAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006953.2-627s1c1
Sequence:CCGGCATGATCGTCATCACTTCCATCTCGAGATGGAAGTGATGACGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006953.2-381s1c1
Sequence:CCGGCTCACAGATCCTGAATGCCTACTCGAGTAGGCATTCAGGATCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006953.2-623s1c1
Sequence:CCGGGAGGCATGATCGTCATCACTTCTCGAGAAGTGATGACGATCATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006953.3-96s21c1
Sequence:CCGGCCAACTGGCCAGTGTGACTTTCTCGAGAAAGTCACACTGGCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006953.3-851s21c1
Sequence:CCGGTGGACAGGGCTGAGGTGTATTCTCGAGAATACACCTCAGCCCTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006953.3-757s21c1
Sequence:CCGGACGACTCACGACTCCCAAATCCTCGAGGATTTGGGAGTCGTGAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006953
UPK3A MISSION shRNA shRNA Plasmid DNA
uroplakin 3A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006953.2-498s1c1
Sequence:CCGGCAAGTATGTCCTGGTCAATATCTCGAGATATTGACCAGGACATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006953.2-662s1c1
Sequence:CCGGCCTTCTTTCTACTTGTGGGTTCTCGAGAACCCACAAGTAGAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006953.2-627s1c1
Sequence:CCGGCATGATCGTCATCACTTCCATCTCGAGATGGAAGTGATGACGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006953.2-381s1c1
Sequence:CCGGCTCACAGATCCTGAATGCCTACTCGAGTAGGCATTCAGGATCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006953.2-623s1c1
Sequence:CCGGGAGGCATGATCGTCATCACTTCTCGAGAAGTGATGACGATCATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006953.3-96s21c1
Sequence:CCGGCCAACTGGCCAGTGTGACTTTCTCGAGAAAGTCACACTGGCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006953.3-851s21c1
Sequence:CCGGTGGACAGGGCTGAGGTGTATTCTCGAGAATACACCTCAGCCCTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006953.3-757s21c1
Sequence:CCGGACGACTCACGACTCCCAAATCCTCGAGGATTTGGGAGTCGTGAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006953
UPK3A MISSION shRNA Lentiviral Transduction Particles
uroplakin 3A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006953.2-498s1c1
Sequence:CCGGCAAGTATGTCCTGGTCAATATCTCGAGATATTGACCAGGACATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006953.2-662s1c1
Sequence:CCGGCCTTCTTTCTACTTGTGGGTTCTCGAGAACCCACAAGTAGAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006953.2-627s1c1
Sequence:CCGGCATGATCGTCATCACTTCCATCTCGAGATGGAAGTGATGACGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006953.2-381s1c1
Sequence:CCGGCTCACAGATCCTGAATGCCTACTCGAGTAGGCATTCAGGATCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006953.2-623s1c1
Sequence:CCGGGAGGCATGATCGTCATCACTTCTCGAGAAGTGATGACGATCATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006953.3-96s21c1
Sequence:CCGGCCAACTGGCCAGTGTGACTTTCTCGAGAAAGTCACACTGGCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006953.3-851s21c1
Sequence:CCGGTGGACAGGGCTGAGGTGTATTCTCGAGAATACACCTCAGCCCTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006953.3-757s21c1
Sequence:CCGGACGACTCACGACTCCCAAATCCTCGAGGATTTGGGAGTCGTGAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023478
UPK3A MISSION shRNA Bacterial Glycerol Stock
uroplakin 3A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023478.1-789s1c1
Sequence:CCGGGCCTTCCTACTCATCTGTGAACTCGAGTTCACAGATGAGTAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023478.1-254s1c1
Sequence:CCGGTGAGCACTACTTTCCGGCAAACTCGAGTTTGCCGGAAAGTAGTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023478.1-379s1c1
Sequence:CCGGGAGATCCTGAACGCATACCTACTCGAGTAGGTATGCGTTCAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023478.1-476s1c1
Sequence:CCGGCCACTGAGTACAGATTCAAATCTCGAGATTTGAATCTGTACTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023478.1-177s1c1
Sequence:CCGGCGAGGTTTACCTCTATGCTATCTCGAGATAGCATAGAGGTAAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023478.2-558s21c1
Sequence:CCGGCTGAGTACAGATTCAAGTATGCTCGAGCATACTTGAATCTGTACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023478.2-333s21c1
Sequence:CCGGTGAGCACCACTTTCCGGCAAACTCGAGTTTGCCGGAAAGTGGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023478
UPK3A MISSION shRNA shRNA Plasmid DNA
uroplakin 3A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023478.1-789s1c1
Sequence:CCGGGCCTTCCTACTCATCTGTGAACTCGAGTTCACAGATGAGTAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023478.1-254s1c1
Sequence:CCGGTGAGCACTACTTTCCGGCAAACTCGAGTTTGCCGGAAAGTAGTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023478.1-379s1c1
Sequence:CCGGGAGATCCTGAACGCATACCTACTCGAGTAGGTATGCGTTCAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023478.1-476s1c1
Sequence:CCGGCCACTGAGTACAGATTCAAATCTCGAGATTTGAATCTGTACTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023478.1-177s1c1
Sequence:CCGGCGAGGTTTACCTCTATGCTATCTCGAGATAGCATAGAGGTAAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023478.2-558s21c1
Sequence:CCGGCTGAGTACAGATTCAAGTATGCTCGAGCATACTTGAATCTGTACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023478.2-333s21c1
Sequence:CCGGTGAGCACCACTTTCCGGCAAACTCGAGTTTGCCGGAAAGTGGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023478
UPK3A MISSION shRNA Lentiviral Transduction Particles
uroplakin 3A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023478.1-789s1c1
Sequence:CCGGGCCTTCCTACTCATCTGTGAACTCGAGTTCACAGATGAGTAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023478.1-254s1c1
Sequence:CCGGTGAGCACTACTTTCCGGCAAACTCGAGTTTGCCGGAAAGTAGTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023478.1-379s1c1
Sequence:CCGGGAGATCCTGAACGCATACCTACTCGAGTAGGTATGCGTTCAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023478.1-476s1c1
Sequence:CCGGCCACTGAGTACAGATTCAAATCTCGAGATTTGAATCTGTACTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023478.1-177s1c1
Sequence:CCGGCGAGGTTTACCTCTATGCTATCTCGAGATAGCATAGAGGTAAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023478.2-558s21c1
Sequence:CCGGCTGAGTACAGATTCAAGTATGCTCGAGCATACTTGAATCTGTACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023478.2-333s21c1
Sequence:CCGGTGAGCACCACTTTCCGGCAAACTCGAGTTTGCCGGAAAGTGGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks