EMAIL THIS PAGE TO A FRIEND

UPK3B

uroplakin 3B

Synonyms: P35 UP3B UPIIIB
UniProtKB ID: Q9BT76, A8K231, A8MZA8, B3KPU5, Q75MM5, Q86W06
Gene ID:
Human(80761) Summary: UPK3B is a minor component of the apical plaques of mammalian urothelium that binds and dimerizes with uroplakin-1b (UPK1B; MIM 602380), one of the major conserved urothelium membrane proteins. The other major conserved integral membrane proteins of urothelial plaques are UPK1A (MIM 611557), UPK2 (MIM 611558), and UPK3A (MIM 611559) (Deng et al., 2002 [PubMed 12446744]
Mouse(100647) uroplakin 3B
Rat(360790) uroplakin 3B
cow(282115) uroplakin 3B
sheep(101116795) uroplakin 3B
chicken(101668319) uroplakin 3B
chicken(101749942) uroplakin 3B
dog(607577) uroplakin 3B
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182684 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175309 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175309 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175309 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030570 Rosetta Predictions human pricing
NM_182683 Rosetta Predictions human pricing
NM_182684 Rosetta Predictions human pricing
XM_001077178 Rosetta Predictions rat pricing
XM_341056 Rosetta Predictions rat pricing
NM_175309 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141181 predicted 1080
2 SASI_Hs01_00141183 predicted 1065
3 SASI_Hs01_00141184 predicted 1130
4 SASI_Hs01_00141182 predicted 1088
5 SASI_Hs01_00141185 predicted 475
6 SASI_Hs01_00141186 predicted 573
7 SASI_Hs01_00141187 predicted 1174
8 SASI_Hs01_00141188 predicted 1182
9 SASI_Hs01_00141189 predicted 889
10 SASI_Hs01_00141190 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141051 predicted 922
2 SASI_Hs01_00141052 predicted 921
3 SASI_Hs01_00141053 predicted 910
4 SASI_Hs01_00141054 predicted 972
5 SASI_Hs01_00141055 predicted 315
6 SASI_Hs01_00141056 predicted 408
7 SASI_Hs01_00141057 predicted 733
8 SASI_Hs01_00141058 predicted 1022
9 SASI_Hs01_00141059 predicted 1022
10 SASI_Hs01_00141060 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218159 predicted 995
2 SASI_Hs01_00218161 predicted 977
3 SASI_Hs01_00218162 predicted 1053
4 SASI_Hs01_00218160 predicted 1001
5 SASI_Hs01_00218163 predicted 310
6 SASI_Hs01_00218164 predicted 406
7 SASI_Hs01_00218165 predicted 1093
8 SASI_Hs01_00218166 predicted 669
9 SASI_Hs01_00218167 predicted 677
10 SASI_Hs01_00218168 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356072 predicted 577
2 SASI_Rn02_00356073 predicted 530
3 SASI_Rn02_00356074 predicted 473
4 SASI_Rn02_00356075 predicted 374
5 SASI_Rn02_00356076 predicted 489
6 SASI_Rn02_00356077 predicted 300
7 SASI_Rn02_00356078 predicted 596
8 SASI_Rn02_00356079 predicted 350
9 SASI_Rn02_00356080 predicted 533
10 SASI_Rn02_00356081 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392289 predicted 802
2 SASI_Rn02_00392290 predicted 789
3 SASI_Rn02_00392291 predicted 763
4 SASI_Rn02_00392292 predicted 748
5 SASI_Rn02_00392293 predicted 730
6 SASI_Rn02_00392294 predicted 801
7 SASI_Rn02_00392295 predicted 795
8 SASI_Rn02_00392296 predicted 794
9 SASI_Rn02_00392297 predicted 821
10 SASI_Rn02_00392298 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050675 predicted 900
2 SASI_Mm01_00050676 predicted 751
3 SASI_Mm02_00346075 predicted 679
4 SASI_Mm01_00050677 predicted 597
5 SASI_Mm01_00050678 predicted 376
6 SASI_Mm01_00050679 predicted 518
7 SASI_Mm01_00050680 predicted 712
8 SASI_Mm01_00050681 predicted 798
9 SASI_Mm01_00050682 predicted 751
10 SASI_Mm02_00346076 predicted 761
11 SASI_Mm01_00050683 predicted 771
12 SASI_Mm01_00050684 predicted 569
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182684
UPK3B MISSION shRNA Bacterial Glycerol Stock
uroplakin 3B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182684.1-1266s21c1
Sequence:CCGGGTTGCACTCAGGAGGGTTTAGCTCGAGCTAAACCCTCCTGAGTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182684.1-675s1c1
Sequence:CCGGTGGACCCTATCGGGTGAAGTTCTCGAGAACTTCACCCGATAGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182684.1-948s1c1
Sequence:CCGGCTTCATGGGCAAGCGCTACATCTCGAGATGTAGCGCTTGCCCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183288    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182684.1-1337s1c1
Sequence:CCGGGATCTGGTTGTTTAGAAGCATCTCGAGATGCTTCTAAACAACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182684.1-812s1c1
Sequence:CCGGGCAGCATGATCGTCATTACCTCTCGAGAGGTAATGACGATCATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182684.1-816s1c1
Sequence:CCGGCATGATCGTCATTACCTCCATCTCGAGATGGAGGTAATGACGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182684
UPK3B MISSION shRNA shRNA Plasmid DNA
uroplakin 3B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182684.1-1266s21c1
Sequence:CCGGGTTGCACTCAGGAGGGTTTAGCTCGAGCTAAACCCTCCTGAGTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182684.1-675s1c1
Sequence:CCGGTGGACCCTATCGGGTGAAGTTCTCGAGAACTTCACCCGATAGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182684.1-948s1c1
Sequence:CCGGCTTCATGGGCAAGCGCTACATCTCGAGATGTAGCGCTTGCCCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183288    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182684.1-1337s1c1
Sequence:CCGGGATCTGGTTGTTTAGAAGCATCTCGAGATGCTTCTAAACAACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182684.1-812s1c1
Sequence:CCGGGCAGCATGATCGTCATTACCTCTCGAGAGGTAATGACGATCATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182684.1-816s1c1
Sequence:CCGGCATGATCGTCATTACCTCCATCTCGAGATGGAGGTAATGACGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182684
UPK3B MISSION shRNA Lentiviral Transduction Particles
uroplakin 3B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182684.1-1266s21c1
Sequence:CCGGGTTGCACTCAGGAGGGTTTAGCTCGAGCTAAACCCTCCTGAGTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182684.1-675s1c1
Sequence:CCGGTGGACCCTATCGGGTGAAGTTCTCGAGAACTTCACCCGATAGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182684.1-948s1c1
Sequence:CCGGCTTCATGGGCAAGCGCTACATCTCGAGATGTAGCGCTTGCCCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183288    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182684.1-1337s1c1
Sequence:CCGGGATCTGGTTGTTTAGAAGCATCTCGAGATGCTTCTAAACAACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182684.1-812s1c1
Sequence:CCGGGCAGCATGATCGTCATTACCTCTCGAGAGGTAATGACGATCATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182684.1-816s1c1
Sequence:CCGGCATGATCGTCATTACCTCCATCTCGAGATGGAGGTAATGACGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175309
UPK3B MISSION shRNA Bacterial Glycerol Stock
uroplakin 3B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175309.3-1797s1c1
Sequence:CCGGCGGCTCACTCAGCATCATTTACTCGAGTAAATGATGCTGAGTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175309.3-609s1c1
Sequence:CCGGGACGGCCACTATATGACATTACTCGAGTAATGTCATATAGTGGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175309.3-762s1c1
Sequence:CCGGCCTTACAGTGTGAAGTTCCTTCTCGAGAAGGAACTTCACACTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175309.3-895s1c1
Sequence:CCGGGCTGTATGATCGTCATAACTTCTCGAGAAGTTATGACGATCATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175309.3-892s1c1
Sequence:CCGGGCGGCTGTATGATCGTCATAACTCGAGTTATGACGATCATACAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175309
UPK3B MISSION shRNA shRNA Plasmid DNA
uroplakin 3B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175309.3-1797s1c1
Sequence:CCGGCGGCTCACTCAGCATCATTTACTCGAGTAAATGATGCTGAGTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175309.3-609s1c1
Sequence:CCGGGACGGCCACTATATGACATTACTCGAGTAATGTCATATAGTGGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175309.3-762s1c1
Sequence:CCGGCCTTACAGTGTGAAGTTCCTTCTCGAGAAGGAACTTCACACTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175309.3-895s1c1
Sequence:CCGGGCTGTATGATCGTCATAACTTCTCGAGAAGTTATGACGATCATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175309.3-892s1c1
Sequence:CCGGGCGGCTGTATGATCGTCATAACTCGAGTTATGACGATCATACAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175309
UPK3B MISSION shRNA Lentiviral Transduction Particles
uroplakin 3B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175309.3-1797s1c1
Sequence:CCGGCGGCTCACTCAGCATCATTTACTCGAGTAAATGATGCTGAGTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175309.3-609s1c1
Sequence:CCGGGACGGCCACTATATGACATTACTCGAGTAATGTCATATAGTGGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175309.3-762s1c1
Sequence:CCGGCCTTACAGTGTGAAGTTCCTTCTCGAGAAGGAACTTCACACTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175309.3-895s1c1
Sequence:CCGGGCTGTATGATCGTCATAACTTCTCGAGAAGTTATGACGATCATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175309.3-892s1c1
Sequence:CCGGGCGGCTGTATGATCGTCATAACTCGAGTTATGACGATCATACAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks