EMAIL THIS PAGE TO A FRIEND

UPK3BL

uroplakin 3B-like

Synonyms: UPLP
UniProtKB ID: B0FP48
Gene ID:
Mouse(69665) uroplakin 3B-like
Rat(367994) uroplakin 3B-like
chicken(417514) uroplakin 3B-like
dog(608057) uroplakin-3b-like protein-like
domestic cat(101083388) uroplakin 3B-like
domestic guinea pig(100730459) uroplakin 3B-like
naked mole-rat(101717719) uroplakin 3B-like
cow(617471) uroplakin 3B-like
sheep(101117044) uroplakin 3B-like
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027158 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027158 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027158 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001114403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001114403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001114403 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU082331 MISSION® esiRNA esiRNA targeting mouse 2310043J07Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114403 Rosetta Predictions human pricing
NM_001109020 Rosetta Predictions rat pricing
XM_485688 Rosetta Predictions mouse pricing
XM_916650 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326624 predicted 408
2 SASI_Hs02_00326625 predicted 416
3 SASI_Hs02_00326626 predicted 465
4 SASI_Hs02_00326627 predicted 533
5 SASI_Hs02_00326628 predicted 553
6 SASI_Hs02_00326629 predicted 557
7 SASI_Hs02_00326630 predicted 468
8 SASI_Hs02_00326631 predicted 651
9 SASI_Hs02_00326632 predicted 591
10 SASI_Hs02_00326633 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244384 predicted 644
2 SASI_Rn02_00244385 predicted 521
3 SASI_Rn02_00244386 predicted 689
4 SASI_Rn02_00244387 predicted 529
5 SASI_Rn02_00244388 predicted 564
6 SASI_Rn02_00244389 predicted 295
7 SASI_Rn02_00244390 predicted 456
8 SASI_Rn02_00244391 predicted 519
9 SASI_Rn02_00244392 predicted 683
10 SASI_Rn02_00244393 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426686 predicted 263
2 SASI_Mm02_00426687 predicted 483
3 SASI_Mm02_00426688 predicted 508
4 SASI_Mm01_00212494 predicted 262
5 SASI_Mm02_00426689 predicted 563
6 SASI_Mm02_00426690 predicted 469
7 SASI_Mm02_00426691 predicted 366
8 SASI_Mm02_00426692 predicted 355
9 SASI_Mm02_00426693 predicted 474
10 SASI_Mm02_00426694 predicted 504
11 SASI_Mm01_00212493 predicted 832
12 SASI_Mm01_00212495 predicted 767
13 SASI_Mm01_00212496 predicted 761
14 SASI_Mm01_00212497 predicted 721
15 SASI_Mm01_00212498 predicted 773
16 SASI_Mm01_00212499 predicted 205
17 SASI_Mm01_00212500 predicted 826
18 SASI_Mm01_00212501 predicted 765
19 SASI_Mm01_00212502 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440474 predicted 375
2 SASI_Mm02_00440475 predicted 480
3 SASI_Mm02_00440476 predicted 646
4 SASI_Mm02_00440477 predicted 265
5 SASI_Mm02_00440478 predicted 466
6 SASI_Mm02_00440479 predicted 204
7 SASI_Mm02_00440480 predicted 353
8 SASI_Mm02_00440481 predicted 676
9 SASI_Mm02_00440482 predicted 418
10 SASI_Mm02_00440483 predicted 240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027158
VALIDATED
UPK3BL MISSION shRNA Bacterial Glycerol Stock
uroplakin 3B-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027158.1-209s21c1
Sequence:CCGGGACGGGTCTGGAGAGCATTAACTCGAGTTAATGCTCTCCAGACCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027158.1-785s21c1
Sequence:CCGGCGCTTGCAGCTTGAGTACTTCCTCGAGGAAGTACTCAAGCTGCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027158.1-432s21c1
Sequence:CCGGGACCGCAATGGCTACTATCTCCTCGAGGAGATAGTAGCCATTGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027158.1-763s21c1
Sequence:CCGGTCTTCCTCGTACTGGTCATATCTCGAGATATGACCAGTACGAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027158.1-706s21c1
Sequence:CCGGAGGGCACTGTGGTCATCATTGCTCGAGCAATGATGACCACAGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027158
VALIDATED
UPK3BL MISSION shRNA shRNA Plasmid DNA
uroplakin 3B-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027158.1-209s21c1
Sequence:CCGGGACGGGTCTGGAGAGCATTAACTCGAGTTAATGCTCTCCAGACCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027158.1-785s21c1
Sequence:CCGGCGCTTGCAGCTTGAGTACTTCCTCGAGGAAGTACTCAAGCTGCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027158.1-432s21c1
Sequence:CCGGGACCGCAATGGCTACTATCTCCTCGAGGAGATAGTAGCCATTGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027158.1-763s21c1
Sequence:CCGGTCTTCCTCGTACTGGTCATATCTCGAGATATGACCAGTACGAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027158.1-706s21c1
Sequence:CCGGAGGGCACTGTGGTCATCATTGCTCGAGCAATGATGACCACAGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027158
VALIDATED
UPK3BL MISSION shRNA Lentiviral Transduction Particles
uroplakin 3B-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027158.1-209s21c1
Sequence:CCGGGACGGGTCTGGAGAGCATTAACTCGAGTTAATGCTCTCCAGACCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027158.1-785s21c1
Sequence:CCGGCGCTTGCAGCTTGAGTACTTCCTCGAGGAAGTACTCAAGCTGCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027158.1-432s21c1
Sequence:CCGGGACCGCAATGGCTACTATCTCCTCGAGGAGATAGTAGCCATTGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027158.1-763s21c1
Sequence:CCGGTCTTCCTCGTACTGGTCATATCTCGAGATATGACCAGTACGAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027158.1-706s21c1
Sequence:CCGGAGGGCACTGTGGTCATCATTGCTCGAGCAATGATGACCACAGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001114403
UPK3BL MISSION shRNA Bacterial Glycerol Stock
uroplakin 3B-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114403.1-777s21c1
Sequence:CCGGGCAGGGAGTGTGAGAAGATACCTCGAGGTATCTTCTCACACTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114403.1-663s21c1
Sequence:CCGGATCATCGCCATCCTGTCTATCCTCGAGGATAGACAGGATGGCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114403.1-538s21c1
Sequence:CCGGTGAAGTTCCTGGTGATGAATGCTCGAGCATTCATCACCAGGAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114403.1-707s21c1
Sequence:CCGGCCTCCTGGCTGTGCTCATATACTCGAGTATATGAGCACAGCCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114403.1-1038s21c1
Sequence:CCGGCCTCACGGGTTCAAGCGATTTCTCGAGAAATCGCTTGAACCCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001114403
UPK3BL MISSION shRNA shRNA Plasmid DNA
uroplakin 3B-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114403.1-777s21c1
Sequence:CCGGGCAGGGAGTGTGAGAAGATACCTCGAGGTATCTTCTCACACTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114403.1-663s21c1
Sequence:CCGGATCATCGCCATCCTGTCTATCCTCGAGGATAGACAGGATGGCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114403.1-538s21c1
Sequence:CCGGTGAAGTTCCTGGTGATGAATGCTCGAGCATTCATCACCAGGAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114403.1-707s21c1
Sequence:CCGGCCTCCTGGCTGTGCTCATATACTCGAGTATATGAGCACAGCCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114403.1-1038s21c1
Sequence:CCGGCCTCACGGGTTCAAGCGATTTCTCGAGAAATCGCTTGAACCCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001114403
UPK3BL MISSION shRNA Lentiviral Transduction Particles
uroplakin 3B-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114403.1-777s21c1
Sequence:CCGGGCAGGGAGTGTGAGAAGATACCTCGAGGTATCTTCTCACACTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114403.1-663s21c1
Sequence:CCGGATCATCGCCATCCTGTCTATCCTCGAGGATAGACAGGATGGCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114403.1-538s21c1
Sequence:CCGGTGAAGTTCCTGGTGATGAATGCTCGAGCATTCATCACCAGGAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114403.1-707s21c1
Sequence:CCGGCCTCCTGGCTGTGCTCATATACTCGAGTATATGAGCACAGCCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114403.1-1038s21c1
Sequence:CCGGCCTCACGGGTTCAAGCGATTTCTCGAGAAATCGCTTGAACCCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks