EMAIL THIS PAGE TO A FRIEND

UPP1

uridine phosphorylase 1

Synonyms: UDRPASE UP UPASE UPP
UniProtKB ID: Q16831, D3DVM4, Q15362
Gene ID:
Human(7378) Summary: The 2 known types of pyrimidine nucleoside phosphorylases, uridine phosphorylase (UP; EC 2.4.2.3) and thymidine phosphorylase (TP; EC 2.4.2.4), in the presence of orthophosphate, catalyze the reversible phosphorolysis of uridine and thymidine or deoxyuridine, respectively, to free bases and ribose-1-phosphate or deoxyribose-1-phosphate. Pyrimidine nucleoside phosphorylases can add ribose or deoxyribose to pyrimidine bases to form nucleosides that can be incorporated into RNA or DNA (Watanabe and Uchida, 1995 [PubMed 7488099]
Mouse(22271) uridine phosphorylase 1
Rat(289801) uridine phosphorylase 1
Zebrafish(503707) uridine phosphorylase 1
domestic cat(101082223) uridine phosphorylase 1
dog(480772) uridine phosphorylase 1
chicken(420942) uridine phosphorylase 1
cow(515029) uridine phosphorylase 1
sheep(101107953) uridine phosphorylase 1
naked mole-rat(101702131) uridine phosphorylase 1
domestic guinea pig(100727838) uridine phosphorylase 1
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
U2760 Anti-UPP1 (176-190) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
U2885 Anti-UPP1 (276-290) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
GW22042A Anti-UPP1 (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
GW22042B Anti-UPP1 (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2102657 Anti-UPP1 antibody produced in rabbit affinity isolated antibody bovine, horse, human, zebrafish, guinea pig, mouse, rat
western blot pricing
SAB2103793 Anti-UPP1 antibody produced in rabbit affinity isolated antibody bovine, mouse, guinea pig, human, rat, rabbit, horse, zebrafish
western blot pricing
HPA055394 Anti-UPP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA054040 Anti-UPP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB1402388 Monoclonal Anti-UPP1, (N-terminal) antibody produced in mouse clone 2F5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003364 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009477 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009477 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009477 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003364 Rosetta Predictions human pricing
NM_181597 Rosetta Predictions human pricing
NM_001030025 Rosetta Predictions rat pricing
NM_009477 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122030 predicted 1359
2 SASI_Hs01_00122031 predicted 553
3 SASI_Hs01_00122032 predicted 782
4 SASI_Hs01_00122033 predicted 550
5 SASI_Hs02_00335515 predicted 825
6 SASI_Hs01_00122034 predicted 879
7 SASI_Hs01_00122035 predicted 1297
8 SASI_Hs01_00122036 predicted 1217
9 SASI_Hs01_00122037 predicted 590
10 SASI_Hs01_00122038 predicted 1467
11 SASI_Hs01_00122039 predicted 1321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078188 predicted 1426
2 SASI_Hs01_00078189 predicted 614
3 SASI_Hs01_00078190 predicted 842
4 SASI_Hs01_00078191 predicted 615
5 SASI_Hs02_00370187 predicted 890
6 SASI_Hs01_00078192 predicted 941
7 SASI_Hs01_00078193 predicted 1359
8 SASI_Hs01_00078194 predicted 1281
9 SASI_Hs01_00078195 predicted 651
10 SASI_Hs01_00078196 predicted 1537
11 SASI_Hs01_00078197 predicted 1387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068523 predicted 723
2 SASI_Rn02_00203531 predicted 676
3 SASI_Rn01_00068524 predicted 245
4 SASI_Rn01_00068525 predicted 376
5 SASI_Rn01_00068527 predicted 479
6 SASI_Rn01_00068528 predicted 614
7 SASI_Rn01_00068529 predicted 581
8 SASI_Rn01_00068530 predicted 243
9 SASI_Rn01_00068531 predicted 438
10 SASI_Rn01_00068532 predicted 251
11 SASI_Rn01_00068526 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143940 predicted 1013
2 SASI_Mm01_00143941 predicted 891
3 SASI_Mm01_00143942 predicted 503
4 SASI_Mm01_00143943 predicted 542
5 SASI_Mm01_00143944 predicted 607
6 SASI_Mm01_00143945 predicted 724
7 SASI_Mm01_00143946 predicted 611
8 SASI_Mm01_00143948 predicted 402
9 SASI_Mm01_00143949 predicted 419
10 SASI_Mm02_00316209 predicted 317
11 SASI_Mm01_00143947 predicted 664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003364
VALIDATED
UPP1 MISSION shRNA Bacterial Glycerol Stock
uridine phosphorylase 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003364.2-498s21c1
Sequence:CCGGAGCTGAAAGTCACAATGATTGCTCGAGCAATCATTGTGACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003364.2-1211s21c1
Sequence:CCGGAGATGGAGTCCTCGGTGTTTGCTCGAGCAAACACCGAGGACTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003364.2-1428s21c1
Sequence:CCGGGCTGTGATGACTTGCCATTAACTCGAGTTAATGGCAAGTCATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003364.2-745s21c1
Sequence:CCGGGACCGCTATGCCATGTATAAACTCGAGTTTATACATGGCATAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003364.2-1365s21c1
Sequence:CCGGGAGCTACTTCATCAAGAAGAACTCGAGTTCTTCTTGATGAAGTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003364.2-864s1c1
Sequence:CCGGCAACGTCACTATCATCCGCATCTCGAGATGCGGATGATAGTGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003364.2-622s1c1
Sequence:CCGGGATGTGAAGTTTGTGTGTGTTCTCGAGAACACACACAAACTTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003364.2-1365s1c1
Sequence:CCGGGAGCTACTTCATCAAGAAGAACTCGAGTTCTTCTTGATGAAGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003364.2-832s1c1
Sequence:CCGGCTCATAAAGCTGCTGTACTATCTCGAGATAGTACAGCAGCTTTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003364.2-1428s1c1
Sequence:CCGGGCTGTGATGACTTGCCATTAACTCGAGTTAATGGCAAGTCATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003364.2-831s1c1
Sequence:CCGGGCTCATAAAGCTGCTGTACTACTCGAGTAGTACAGCAGCTTTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003364
VALIDATED
UPP1 MISSION shRNA shRNA Plasmid DNA
uridine phosphorylase 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003364.2-498s21c1
Sequence:CCGGAGCTGAAAGTCACAATGATTGCTCGAGCAATCATTGTGACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003364.2-1211s21c1
Sequence:CCGGAGATGGAGTCCTCGGTGTTTGCTCGAGCAAACACCGAGGACTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003364.2-1428s21c1
Sequence:CCGGGCTGTGATGACTTGCCATTAACTCGAGTTAATGGCAAGTCATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003364.2-745s21c1
Sequence:CCGGGACCGCTATGCCATGTATAAACTCGAGTTTATACATGGCATAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003364.2-1365s21c1
Sequence:CCGGGAGCTACTTCATCAAGAAGAACTCGAGTTCTTCTTGATGAAGTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003364.2-864s1c1
Sequence:CCGGCAACGTCACTATCATCCGCATCTCGAGATGCGGATGATAGTGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003364.2-622s1c1
Sequence:CCGGGATGTGAAGTTTGTGTGTGTTCTCGAGAACACACACAAACTTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003364.2-1365s1c1
Sequence:CCGGGAGCTACTTCATCAAGAAGAACTCGAGTTCTTCTTGATGAAGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003364.2-832s1c1
Sequence:CCGGCTCATAAAGCTGCTGTACTATCTCGAGATAGTACAGCAGCTTTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003364.2-1428s1c1
Sequence:CCGGGCTGTGATGACTTGCCATTAACTCGAGTTAATGGCAAGTCATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003364.2-831s1c1
Sequence:CCGGGCTCATAAAGCTGCTGTACTACTCGAGTAGTACAGCAGCTTTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003364
VALIDATED
UPP1 MISSION shRNA Lentiviral Transduction Particles
uridine phosphorylase 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003364.2-498s21c1
Sequence:CCGGAGCTGAAAGTCACAATGATTGCTCGAGCAATCATTGTGACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003364.2-1211s21c1
Sequence:CCGGAGATGGAGTCCTCGGTGTTTGCTCGAGCAAACACCGAGGACTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003364.2-1428s21c1
Sequence:CCGGGCTGTGATGACTTGCCATTAACTCGAGTTAATGGCAAGTCATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003364.2-745s21c1
Sequence:CCGGGACCGCTATGCCATGTATAAACTCGAGTTTATACATGGCATAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003364.2-1365s21c1
Sequence:CCGGGAGCTACTTCATCAAGAAGAACTCGAGTTCTTCTTGATGAAGTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003364.2-864s1c1
Sequence:CCGGCAACGTCACTATCATCCGCATCTCGAGATGCGGATGATAGTGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003364.2-622s1c1
Sequence:CCGGGATGTGAAGTTTGTGTGTGTTCTCGAGAACACACACAAACTTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003364.2-1365s1c1
Sequence:CCGGGAGCTACTTCATCAAGAAGAACTCGAGTTCTTCTTGATGAAGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003364.2-832s1c1
Sequence:CCGGCTCATAAAGCTGCTGTACTATCTCGAGATAGTACAGCAGCTTTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003364.2-1428s1c1
Sequence:CCGGGCTGTGATGACTTGCCATTAACTCGAGTTAATGGCAAGTCATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003364.2-831s1c1
Sequence:CCGGGCTCATAAAGCTGCTGTACTACTCGAGTAGTACAGCAGCTTTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009477
VALIDATED
UPP1 MISSION shRNA Bacterial Glycerol Stock
uridine phosphorylase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009477.2-557s21c1
Sequence:CCGGGACCGCTACGCCATGTATAAACTCGAGTTTATACATGGCGTAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009477.2-398s21c1
Sequence:CCGGAGCACTAGCACACACGATTTCCTCGAGGAAATCGTGTGTGCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009477.2-643s21c1
Sequence:CCGGGCTCATCAAGATGCTGTACCACTCGAGTGGTACAGCATCTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009477.2-334s21c1
Sequence:CCGGCATCCAACTTTCAAATCCAAACTCGAGTTTGGATTTGAAAGTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009477.2-613s21c1
Sequence:CCGGCATTCCTTCCATCGGCATCATCTCGAGATGATGCCGATGGAAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009477.1-338s1c1
Sequence:CCGGCCAACTTTCAAATCCAAACATCTCGAGATGTTTGGATTTGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009477.1-644s1c1
Sequence:CCGGGCTCATCAAGATGCTGTACCACTCGAGTGGTACAGCATCTTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009477.1-335s1c1
Sequence:CCGGCATCCAACTTTCAAATCCAAACTCGAGTTTGGATTTGAAAGTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009477.1-614s1c1
Sequence:CCGGCATTCCTTCCATCGGCATCATCTCGAGATGATGCCGATGGAAGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009477
VALIDATED
UPP1 MISSION shRNA shRNA Plasmid DNA
uridine phosphorylase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009477.2-557s21c1
Sequence:CCGGGACCGCTACGCCATGTATAAACTCGAGTTTATACATGGCGTAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009477.2-398s21c1
Sequence:CCGGAGCACTAGCACACACGATTTCCTCGAGGAAATCGTGTGTGCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009477.2-643s21c1
Sequence:CCGGGCTCATCAAGATGCTGTACCACTCGAGTGGTACAGCATCTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009477.2-334s21c1
Sequence:CCGGCATCCAACTTTCAAATCCAAACTCGAGTTTGGATTTGAAAGTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009477.2-613s21c1
Sequence:CCGGCATTCCTTCCATCGGCATCATCTCGAGATGATGCCGATGGAAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009477.1-338s1c1
Sequence:CCGGCCAACTTTCAAATCCAAACATCTCGAGATGTTTGGATTTGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009477.1-644s1c1
Sequence:CCGGGCTCATCAAGATGCTGTACCACTCGAGTGGTACAGCATCTTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009477.1-335s1c1
Sequence:CCGGCATCCAACTTTCAAATCCAAACTCGAGTTTGGATTTGAAAGTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009477.1-614s1c1
Sequence:CCGGCATTCCTTCCATCGGCATCATCTCGAGATGATGCCGATGGAAGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009477
VALIDATED
UPP1 MISSION shRNA Lentiviral Transduction Particles
uridine phosphorylase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009477.2-557s21c1
Sequence:CCGGGACCGCTACGCCATGTATAAACTCGAGTTTATACATGGCGTAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009477.2-398s21c1
Sequence:CCGGAGCACTAGCACACACGATTTCCTCGAGGAAATCGTGTGTGCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009477.2-643s21c1
Sequence:CCGGGCTCATCAAGATGCTGTACCACTCGAGTGGTACAGCATCTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009477.2-334s21c1
Sequence:CCGGCATCCAACTTTCAAATCCAAACTCGAGTTTGGATTTGAAAGTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009477.2-613s21c1
Sequence:CCGGCATTCCTTCCATCGGCATCATCTCGAGATGATGCCGATGGAAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009477.1-338s1c1
Sequence:CCGGCCAACTTTCAAATCCAAACATCTCGAGATGTTTGGATTTGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009477.1-644s1c1
Sequence:CCGGGCTCATCAAGATGCTGTACCACTCGAGTGGTACAGCATCTTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009477.1-335s1c1
Sequence:CCGGCATCCAACTTTCAAATCCAAACTCGAGTTTGGATTTGAAAGTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009477.1-614s1c1
Sequence:CCGGCATTCCTTCCATCGGCATCATCTCGAGATGATGCCGATGGAAGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks