EMAIL THIS PAGE TO A FRIEND

UPP2

uridine phosphorylase 2

Synonyms: UDRPASE2 UP2 UPASE2
UniProtKB ID: O95045, B3KV87
Gene ID:
Mouse(76654) uridine phosphorylase 2
Rat(295620) uridine phosphorylase 2
domestic guinea pig(100720662) uridine phosphorylase 2
naked mole-rat(101709997) uridine phosphorylase 2
cow(534937) uridine phosphorylase 2
sheep(101112705) uridine phosphorylase 2
Goat(100861371) uridine phosphorylase 2
Zebrafish(393113) uridine phosphorylase 2
chicken(424326) uridine phosphorylase 2
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029692 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029692 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029692 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173355 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144061 MISSION® esiRNA esiRNA human UPP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173355 Rosetta Predictions human pricing
NM_001106481 Rosetta Predictions rat pricing
NM_029692 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139034 predicted 644
2 SASI_Hs02_00368187 predicted 1229
3 SASI_Hs01_00139036 predicted 815
4 SASI_Hs01_00139037 predicted 765
5 SASI_Hs01_00139038 predicted 657
6 SASI_Hs01_00139040 predicted 403
7 SASI_Hs01_00139041 predicted 718
8 SASI_Hs02_00368188 predicted 1059
9 SASI_Hs01_00139043 predicted 391
10 SASI_Hs02_00368189 predicted 1144
11 SASI_Hs01_00139035 predicted 777
12 SASI_Hs01_00139039 predicted 486
13 SASI_Hs01_00139042 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219388 predicted 471
2 SASI_Rn02_00219389 predicted 1048
3 SASI_Rn02_00219390 predicted 532
4 SASI_Rn02_00219391 predicted 629
5 SASI_Rn02_00219392 predicted 1027
6 SASI_Rn02_00219393 predicted 447
7 SASI_Rn02_00219394 predicted 612
8 SASI_Rn02_00219395 predicted 826
9 SASI_Rn02_00219396 predicted 1671
10 SASI_Rn02_00219397 predicted 1716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130672 predicted 467
2 SASI_Mm01_00130673 predicted 738
3 SASI_Mm01_00130674 predicted 582
4 SASI_Mm01_00130675 predicted 628
5 SASI_Mm01_00130676 predicted 295
6 SASI_Mm01_00130677 predicted 999
7 SASI_Mm02_00335739 predicted 382
8 SASI_Mm01_00130678 predicted 930
9 SASI_Mm01_00130679 predicted 208
10 SASI_Mm01_00130680 predicted 746
11 SASI_Mm01_00130671 predicted 810
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029692
UPP2 MISSION shRNA Bacterial Glycerol Stock
uridine phosphorylase 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029692.1-471s1c1
Sequence:CCGGGACAGATACTGCATGTTCAAACTCGAGTTTGAACATGCAGTATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029692.1-1112s1c1
Sequence:CCGGGCTTGGACTTTGTGACCAGATCTCGAGATCTGGTCACAAAGTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029692.1-1077s1c1
Sequence:CCGGCCACAGCTTCTAATCTCAAATCTCGAGATTTGAGATTAGAAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029692.1-1193s1c1
Sequence:CCGGGCCATGTGTTGTTCATAACATCTCGAGATGTTATGAACAACACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029692.2-1395s21c1
Sequence:CCGGGAGTTTCACATGCAGCATTAACTCGAGTTAATGCTGCATGTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029692.2-1300s21c1
Sequence:CCGGTTTAATACTCATGCGAAATTCCTCGAGGAATTTCGCATGAGTATTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029692
UPP2 MISSION shRNA shRNA Plasmid DNA
uridine phosphorylase 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029692.1-471s1c1
Sequence:CCGGGACAGATACTGCATGTTCAAACTCGAGTTTGAACATGCAGTATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029692.1-1112s1c1
Sequence:CCGGGCTTGGACTTTGTGACCAGATCTCGAGATCTGGTCACAAAGTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029692.1-1077s1c1
Sequence:CCGGCCACAGCTTCTAATCTCAAATCTCGAGATTTGAGATTAGAAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029692.1-1193s1c1
Sequence:CCGGGCCATGTGTTGTTCATAACATCTCGAGATGTTATGAACAACACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029692.2-1395s21c1
Sequence:CCGGGAGTTTCACATGCAGCATTAACTCGAGTTAATGCTGCATGTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029692.2-1300s21c1
Sequence:CCGGTTTAATACTCATGCGAAATTCCTCGAGGAATTTCGCATGAGTATTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029692
UPP2 MISSION shRNA Lentiviral Transduction Particles
uridine phosphorylase 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029692.1-471s1c1
Sequence:CCGGGACAGATACTGCATGTTCAAACTCGAGTTTGAACATGCAGTATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029692.1-1112s1c1
Sequence:CCGGGCTTGGACTTTGTGACCAGATCTCGAGATCTGGTCACAAAGTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029692.1-1077s1c1
Sequence:CCGGCCACAGCTTCTAATCTCAAATCTCGAGATTTGAGATTAGAAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029692.1-1193s1c1
Sequence:CCGGGCCATGTGTTGTTCATAACATCTCGAGATGTTATGAACAACACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029692.2-1395s21c1
Sequence:CCGGGAGTTTCACATGCAGCATTAACTCGAGTTAATGCTGCATGTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029692.2-1300s21c1
Sequence:CCGGTTTAATACTCATGCGAAATTCCTCGAGGAATTTCGCATGAGTATTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173355
UPP2 MISSION shRNA Bacterial Glycerol Stock
uridine phosphorylase 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173355.2-1912s1c1
Sequence:CCGGGCTGAGAAATTCATAGCAATTCTCGAGAATTGCTATGAATTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173355.2-482s1c1
Sequence:CCGGGACAGACAGATACTGTATGTACTCGAGTACATACAGTATCTGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173355.2-1044s1c1
Sequence:CCGGGATCAGATCAACTTGCCTCATCTCGAGATGAGGCAAGTTGATCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173355.2-303s1c1
Sequence:CCGGGACATTCTCTATCACTTGGATCTCGAGATCCAAGTGATAGAGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173355
UPP2 MISSION shRNA shRNA Plasmid DNA
uridine phosphorylase 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173355.2-1912s1c1
Sequence:CCGGGCTGAGAAATTCATAGCAATTCTCGAGAATTGCTATGAATTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173355.2-482s1c1
Sequence:CCGGGACAGACAGATACTGTATGTACTCGAGTACATACAGTATCTGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173355.2-1044s1c1
Sequence:CCGGGATCAGATCAACTTGCCTCATCTCGAGATGAGGCAAGTTGATCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173355.2-303s1c1
Sequence:CCGGGACATTCTCTATCACTTGGATCTCGAGATCCAAGTGATAGAGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173355
UPP2 MISSION shRNA Lentiviral Transduction Particles
uridine phosphorylase 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173355.2-1912s1c1
Sequence:CCGGGCTGAGAAATTCATAGCAATTCTCGAGAATTGCTATGAATTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173355.2-482s1c1
Sequence:CCGGGACAGACAGATACTGTATGTACTCGAGTACATACAGTATCTGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173355.2-1044s1c1
Sequence:CCGGGATCAGATCAACTTGCCTCATCTCGAGATGAGGCAAGTTGATCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173355.2-303s1c1
Sequence:CCGGGACATTCTCTATCACTTGGATCTCGAGATCCAAGTGATAGAGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks