EMAIL THIS PAGE TO A FRIEND

UPRT

uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)

Synonyms: FUR1 UPP
UniProtKB ID: Q96BW1, Q5JRL1, Q5JRL3, Q68DN0, Q96MW2
Gene ID:
Human(139596) Summary: This gene encodes uracil phosphoribosyltransferase, which catalyzes the conversion of uracil and 5-phosphoribosyl-1-R-diphosphate to uridine monophosphate (UMP). This reaction is an important part of nucleotide metabolism, specifically the pyrimidine salvage pathway. The enzyme localizes to the nucleus and cytoplasm. The protein is a potential target for rational design of drugs to treat parasitic infections and cancer. [provided by RefSeq, Nov 2009]
Mouse(331487) uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)
Rat(317237) uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)
Zebrafish(404623) uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)
chicken(422327) uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)
domestic cat(101083245) uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)
dog(480960) uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)
cow(540851) uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)
naked mole-rat(101721108) uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)
domestic guinea pig(100724479) uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)
201 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145052 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145052 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145052 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145052 Rosetta Predictions human pricing
XM_001053733 Rosetta Predictions rat pricing
XM_228538 Rosetta Predictions rat pricing
NM_001081189 Rosetta Predictions mouse pricing
XM_284721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130211 predicted 766
2 SASI_Hs01_00130212 predicted 632
3 SASI_Hs02_00364935 predicted 751
4 SASI_Hs01_00130213 predicted 962
5 SASI_Hs01_00130214 predicted 836
6 SASI_Hs01_00130215 predicted 575
7 SASI_Hs01_00130216 predicted 952
8 SASI_Hs01_00130217 predicted 849
9 SASI_Hs01_00130219 predicted 899
10 SASI_Hs02_00364936 predicted 407
11 SASI_Hs01_00130218 predicted 1085
12 SASI_Hs01_00130220 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273406 predicted 826
2 SASI_Rn02_00273407 predicted 830
3 SASI_Rn02_00273408 predicted 768
4 SASI_Rn02_00273409 predicted 801
5 SASI_Rn02_00273410 predicted 862
6 SASI_Rn02_00273411 predicted 781
7 SASI_Rn02_00273412 predicted 690
8 SASI_Rn02_00273413 predicted 227
9 SASI_Rn02_00273414 predicted 808
10 SASI_Rn02_00273415 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385210 predicted 829
2 SASI_Rn02_00385211 predicted 834
3 SASI_Rn02_00385212 predicted 688
4 SASI_Rn02_00385213 predicted 771
5 SASI_Rn02_00385214 predicted 803
6 SASI_Rn02_00385215 predicted 863
7 SASI_Rn02_00385216 predicted 777
8 SASI_Rn02_00385217 predicted 695
9 SASI_Rn02_00385218 predicted 809
10 SASI_Rn02_00385219 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296061 predicted 820
2 SASI_Mm02_00296062 predicted 833
3 SASI_Mm02_00296063 predicted 773
4 SASI_Mm02_00296064 predicted 759
5 SASI_Mm02_00296065 predicted 773
6 SASI_Mm02_00296066 predicted 226
7 SASI_Mm02_00296067 predicted 859
8 SASI_Mm02_00296068 predicted 736
9 SASI_Mm02_00296069 predicted 504
10 SASI_Mm02_00296070 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_284721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212595 predicted 831
2 SASI_Mm01_00212596 predicted 837
3 SASI_Mm01_00212597 predicted 784
4 SASI_Mm01_00212598 predicted 773
5 SASI_Mm01_00212599 predicted 785
6 SASI_Mm01_00212600 predicted 224
7 SASI_Mm01_00212601 predicted 866
8 SASI_Mm01_00212602 predicted 744
9 SASI_Mm01_00212603 predicted 512
10 SASI_Mm01_00212604 predicted 612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145052
VALIDATED
UPRT MISSION shRNA Bacterial Glycerol Stock
uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-683s21c1
Sequence:CCGGACCACTCCAACAGGGTACAAGCTCGAGCTTGTACCCTGTTGGAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-1017s21c1
Sequence:CCGGATGGTGCCAAATCAATCATTCCTCGAGGAATGATTGATTTGGCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-534s21c1
Sequence:CCGGTGCCTATGAATGATCAGATACCTCGAGGTATCTGATCATTCATAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-971s21c1
Sequence:CCGGGTTCAACCCAGTGTTATCATCCTCGAGGATGATAACACTGGGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-921s21c1
Sequence:CCGGGCACTGGAAATACTGTAATTGCTCGAGCAATTACAGTATTTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-789s21c1
Sequence:CCGGGCTGTCGATCCATACGAATTGCTCGAGCAATTCGTATGGATCGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-761s21c1
Sequence:CCGGGAGGCAATGGAACAAGGTTTACTCGAGTAAACCTTGTTCCATTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145052.1-166s1c1
Sequence:CCGGCCTGTCACAACCAGCAAGTAACTCGAGTTACTTGCTGGTTGTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_145052.1-549s1c1
Sequence:CCGGGCGGATCGTTTGATCAGACTTCTCGAGAAGTCTGATCAAACGATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_145052.1-1445s1c1
Sequence:CCGGGCTCTACTAAGGTTTCACATACTCGAGTATGTGAAACCTTAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145052.1-632s1c1
Sequence:CCGGGTACAAGTATGAAGGAGTGAACTCGAGTTCACTCCTTCATACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145052.1-773s1c1
Sequence:CCGGGACACAAAGAGCCAAAGTATACTCGAGTATACTTTGGCTCTTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_145052.1-552s1c1
Sequence:CCGGGATCGTTTGATCAGACTTGTTCTCGAGAACAAGTCTGATCAAACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_145052.1-1862s1c1
Sequence:CCGGGCTGGATTTCATGGCCAGTAACTCGAGTTACTGGCCATGAAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145052
VALIDATED
UPRT MISSION shRNA shRNA Plasmid DNA
uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-683s21c1
Sequence:CCGGACCACTCCAACAGGGTACAAGCTCGAGCTTGTACCCTGTTGGAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-1017s21c1
Sequence:CCGGATGGTGCCAAATCAATCATTCCTCGAGGAATGATTGATTTGGCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-534s21c1
Sequence:CCGGTGCCTATGAATGATCAGATACCTCGAGGTATCTGATCATTCATAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-971s21c1
Sequence:CCGGGTTCAACCCAGTGTTATCATCCTCGAGGATGATAACACTGGGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-921s21c1
Sequence:CCGGGCACTGGAAATACTGTAATTGCTCGAGCAATTACAGTATTTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-789s21c1
Sequence:CCGGGCTGTCGATCCATACGAATTGCTCGAGCAATTCGTATGGATCGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-761s21c1
Sequence:CCGGGAGGCAATGGAACAAGGTTTACTCGAGTAAACCTTGTTCCATTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145052.1-166s1c1
Sequence:CCGGCCTGTCACAACCAGCAAGTAACTCGAGTTACTTGCTGGTTGTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_145052.1-549s1c1
Sequence:CCGGGCGGATCGTTTGATCAGACTTCTCGAGAAGTCTGATCAAACGATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_145052.1-1445s1c1
Sequence:CCGGGCTCTACTAAGGTTTCACATACTCGAGTATGTGAAACCTTAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145052.1-632s1c1
Sequence:CCGGGTACAAGTATGAAGGAGTGAACTCGAGTTCACTCCTTCATACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145052.1-773s1c1
Sequence:CCGGGACACAAAGAGCCAAAGTATACTCGAGTATACTTTGGCTCTTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_145052.1-552s1c1
Sequence:CCGGGATCGTTTGATCAGACTTGTTCTCGAGAACAAGTCTGATCAAACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_145052.1-1862s1c1
Sequence:CCGGGCTGGATTTCATGGCCAGTAACTCGAGTTACTGGCCATGAAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145052
VALIDATED
UPRT MISSION shRNA Lentiviral Transduction Particles
uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-683s21c1
Sequence:CCGGACCACTCCAACAGGGTACAAGCTCGAGCTTGTACCCTGTTGGAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-1017s21c1
Sequence:CCGGATGGTGCCAAATCAATCATTCCTCGAGGAATGATTGATTTGGCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-534s21c1
Sequence:CCGGTGCCTATGAATGATCAGATACCTCGAGGTATCTGATCATTCATAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-971s21c1
Sequence:CCGGGTTCAACCCAGTGTTATCATCCTCGAGGATGATAACACTGGGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-921s21c1
Sequence:CCGGGCACTGGAAATACTGTAATTGCTCGAGCAATTACAGTATTTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-789s21c1
Sequence:CCGGGCTGTCGATCCATACGAATTGCTCGAGCAATTCGTATGGATCGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145052.3-761s21c1
Sequence:CCGGGAGGCAATGGAACAAGGTTTACTCGAGTAAACCTTGTTCCATTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145052.1-166s1c1
Sequence:CCGGCCTGTCACAACCAGCAAGTAACTCGAGTTACTTGCTGGTTGTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_145052.1-549s1c1
Sequence:CCGGGCGGATCGTTTGATCAGACTTCTCGAGAAGTCTGATCAAACGATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_145052.1-1445s1c1
Sequence:CCGGGCTCTACTAAGGTTTCACATACTCGAGTATGTGAAACCTTAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145052.1-632s1c1
Sequence:CCGGGTACAAGTATGAAGGAGTGAACTCGAGTTCACTCCTTCATACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145052.1-773s1c1
Sequence:CCGGGACACAAAGAGCCAAAGTATACTCGAGTATACTTTGGCTCTTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_145052.1-552s1c1
Sequence:CCGGGATCGTTTGATCAGACTTGTTCTCGAGAACAAGTCTGATCAAACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_145052.1-1862s1c1
Sequence:CCGGGCTGGATTTCATGGCCAGTAACTCGAGTTACTGGCCATGAAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081189
UPRT MISSION shRNA Bacterial Glycerol Stock
uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081189.1-828s21c1
Sequence:CCGGCAAAGGGCCAAAGTATATTATCTCGAGATAATATACTTTGGCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081189.1-636s21c1
Sequence:CCGGCTGAATCAGCTGCCATATAAACTCGAGTTTATATGGCAGCTGATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081189.1-481s21c1
Sequence:CCGGGTGAACTCTCCCGACAGATTGCTCGAGCAATCTGTCGGGAGAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081189.1-537s21c1
Sequence:CCGGATCCGGGAGCTTCAGACTATCCTCGAGGATAGTCTGAAGCTCCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081189.1-215s21c1
Sequence:CCGGCTGTCACAATCGGCAAGTAAACTCGAGTTTACTTGCCGATTGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081189
UPRT MISSION shRNA shRNA Plasmid DNA
uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081189.1-828s21c1
Sequence:CCGGCAAAGGGCCAAAGTATATTATCTCGAGATAATATACTTTGGCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081189.1-636s21c1
Sequence:CCGGCTGAATCAGCTGCCATATAAACTCGAGTTTATATGGCAGCTGATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081189.1-481s21c1
Sequence:CCGGGTGAACTCTCCCGACAGATTGCTCGAGCAATCTGTCGGGAGAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081189.1-537s21c1
Sequence:CCGGATCCGGGAGCTTCAGACTATCCTCGAGGATAGTCTGAAGCTCCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081189.1-215s21c1
Sequence:CCGGCTGTCACAATCGGCAAGTAAACTCGAGTTTACTTGCCGATTGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081189
UPRT MISSION shRNA Lentiviral Transduction Particles
uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081189.1-828s21c1
Sequence:CCGGCAAAGGGCCAAAGTATATTATCTCGAGATAATATACTTTGGCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081189.1-636s21c1
Sequence:CCGGCTGAATCAGCTGCCATATAAACTCGAGTTTATATGGCAGCTGATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081189.1-481s21c1
Sequence:CCGGGTGAACTCTCCCGACAGATTGCTCGAGCAATCTGTCGGGAGAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081189.1-537s21c1
Sequence:CCGGATCCGGGAGCTTCAGACTATCCTCGAGGATAGTCTGAAGCTCCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081189.1-215s21c1
Sequence:CCGGCTGTCACAATCGGCAAGTAAACTCGAGTTTACTTGCCGATTGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks