EMAIL THIS PAGE TO A FRIEND

UQCC

ubiquinol-cytochrome c reductase complex chaperone

Synonyms: BFZB C20orf44 CBP3
Gene ID:
Human(55245) Summary: This gene encodes a transmembrane protein that is structurally similar to the mouse basic fibroblast growth factor repressed ZIC-binding protein. In mouse this protein may be involved in fibroblast growth factor regulated growth control. In humans, polymorphisms in this gene are associated with variation in human height and osteoarthritis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(56046) ubiquinol-cytochrome c reductase complex chaperone, CBP3 homolog (yeast)
Rat(683512) ubiquinol-cytochrome c reductase complex chaperone
Zebrafish(767788) ubiquinol-cytochrome c reductase complex chaperone
dog(608882) ubiquinol-cytochrome c reductase complex chaperone
chicken(419139) ubiquinol-cytochrome c reductase complex chaperone
Domestic Rabbit(100328705) basic FGF-repressed Zic binding protein
cow(618503) ubiquinol-cytochrome c reductase complex chaperone
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018244 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018888 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018888 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018888 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018244 Rosetta Predictions human pricing
NM_199487 Rosetta Predictions human pricing
NM_199513 Rosetta Predictions human pricing
NM_001109446 Rosetta Predictions rat pricing
NM_018888 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086910 predicted 1248
2 SASI_Hs01_00086912 predicted 1278
3 SASI_Hs02_00351588 predicted 1426
4 SASI_Hs01_00086913 predicted 1334
5 SASI_Hs01_00086914 predicted 1069
6 SASI_Hs01_00086915 predicted 1017
7 SASI_Hs01_00086917 predicted 1377
8 SASI_Hs01_00086918 predicted 935
9 SASI_Hs01_00086919 predicted 1447
10 SASI_Hs02_00351589 predicted 1244
11 SASI_Hs01_00086911 predicted 766
12 SASI_Hs01_00086916 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151780 predicted 672
2 SASI_Hs02_00372879 predicted 589
3 SASI_Hs02_00372880 predicted 731
4 SASI_Hs02_00372881 predicted 359
5 SASI_Hs02_00372882 predicted 405
6 SASI_Hs02_00372883 predicted 238
7 SASI_Hs02_00372884 predicted 389
8 SASI_Hs02_00372885 predicted 479
9 SASI_Hs01_00151784 predicted 929
10 SASI_Hs02_00372886 predicted 491
11 SASI_Hs01_00151779 predicted 1172
12 SASI_Hs01_00151781 predicted 1201
13 SASI_Hs01_00151782 predicted 1259
14 SASI_Hs01_00151783 predicted 994
15 SASI_Hs01_00151785 predicted 975
16 SASI_Hs01_00151786 predicted 1298
17 SASI_Hs01_00151787 predicted 866
18 SASI_Hs01_00151788 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203451 predicted 398
2 SASI_Hs01_00203452 predicted 664
3 SASI_Hs01_00203453 predicted 539
4 SASI_Hs01_00203454 predicted 533
5 SASI_Hs01_00203455 predicted 201
6 SASI_Hs01_00203456 predicted 489
7 SASI_Hs01_00203457 predicted 218
8 SASI_Hs01_00203458 predicted 289
9 SASI_Hs01_00203459 predicted 304
10 SASI_Hs01_00203460 predicted 117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109446 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248487 predicted 393
2 SASI_Rn02_00248488 predicted 463
3 SASI_Rn02_00248489 predicted 388
4 SASI_Rn02_00248490 predicted 609
5 SASI_Rn02_00248491 predicted 688
6 SASI_Rn02_00248492 predicted 406
7 SASI_Rn02_00248493 predicted 313
8 SASI_Rn02_00248494 predicted 229
9 SASI_Rn02_00248495 predicted 1024
10 SASI_Rn02_00248496 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048563 predicted 609
2 SASI_Mm01_00048564 predicted 1341
3 SASI_Mm01_00048565 predicted 1335
4 SASI_Mm01_00048566 predicted 508
5 SASI_Mm01_00048567 predicted 413
6 SASI_Mm01_00048568 predicted 578
7 SASI_Mm01_00048570 predicted 507
8 SASI_Mm01_00048571 predicted 1382
9 SASI_Mm01_00048572 predicted 618
10 SASI_Mm02_00324307 predicted 385
11 SASI_Mm01_00048569 predicted 1257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018244
VALIDATED
UQCC MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase complex chaperone
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018244.3-135s1c1
Sequence:CCGGGATTGATACCTGTGTCTCCTACTCGAGTAGGAGACACAGGTATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_018244.3-815s1c1
Sequence:CCGGGAGTATGTGAGGAAACAGATACTCGAGTATCTGTTTCCTCACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018244.3-1456s1c1
Sequence:CCGGCCTTCTTTATTCCAGGGACTTCTCGAGAAGTCCCTGGAATAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018244.3-794s1c1
Sequence:CCGGCGACATCTTGAATTGCTGGTACTCGAGTACCAGCAATTCAAGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018244.3-532s1c1
Sequence:CCGGGATGTGTCTAGTCCGAATGAACTCGAGTTCATTCGGACTAGACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018244.3-2106s21c1
Sequence:CCGGACCGCTTCTCTCAGTTTATTTCTCGAGAAATAAACTGAGAGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018244.3-762s21c1
Sequence:CCGGGAACCTTCTTCAACCGGAAATCTCGAGATTTCCGGTTGAAGAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018244.3-580s21c1
Sequence:CCGGGTGTCGTATCATAGTTCATTTCTCGAGAAATGAACTATGATACGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018244.3-240s21c1
Sequence:CCGGAGATTCCTGGAATAGACATACCTCGAGGTATGTCTATTCCAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018244
VALIDATED
UQCC MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase complex chaperone
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018244.3-135s1c1
Sequence:CCGGGATTGATACCTGTGTCTCCTACTCGAGTAGGAGACACAGGTATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_018244.3-815s1c1
Sequence:CCGGGAGTATGTGAGGAAACAGATACTCGAGTATCTGTTTCCTCACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018244.3-1456s1c1
Sequence:CCGGCCTTCTTTATTCCAGGGACTTCTCGAGAAGTCCCTGGAATAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018244.3-794s1c1
Sequence:CCGGCGACATCTTGAATTGCTGGTACTCGAGTACCAGCAATTCAAGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018244.3-532s1c1
Sequence:CCGGGATGTGTCTAGTCCGAATGAACTCGAGTTCATTCGGACTAGACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018244.3-2106s21c1
Sequence:CCGGACCGCTTCTCTCAGTTTATTTCTCGAGAAATAAACTGAGAGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018244.3-762s21c1
Sequence:CCGGGAACCTTCTTCAACCGGAAATCTCGAGATTTCCGGTTGAAGAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018244.3-580s21c1
Sequence:CCGGGTGTCGTATCATAGTTCATTTCTCGAGAAATGAACTATGATACGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018244.3-240s21c1
Sequence:CCGGAGATTCCTGGAATAGACATACCTCGAGGTATGTCTATTCCAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018244
VALIDATED
UQCC MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase complex chaperone
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018244.3-135s1c1
Sequence:CCGGGATTGATACCTGTGTCTCCTACTCGAGTAGGAGACACAGGTATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_018244.3-815s1c1
Sequence:CCGGGAGTATGTGAGGAAACAGATACTCGAGTATCTGTTTCCTCACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018244.3-1456s1c1
Sequence:CCGGCCTTCTTTATTCCAGGGACTTCTCGAGAAGTCCCTGGAATAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018244.3-794s1c1
Sequence:CCGGCGACATCTTGAATTGCTGGTACTCGAGTACCAGCAATTCAAGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018244.3-532s1c1
Sequence:CCGGGATGTGTCTAGTCCGAATGAACTCGAGTTCATTCGGACTAGACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018244.3-2106s21c1
Sequence:CCGGACCGCTTCTCTCAGTTTATTTCTCGAGAAATAAACTGAGAGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018244.3-762s21c1
Sequence:CCGGGAACCTTCTTCAACCGGAAATCTCGAGATTTCCGGTTGAAGAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018244.3-580s21c1
Sequence:CCGGGTGTCGTATCATAGTTCATTTCTCGAGAAATGAACTATGATACGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018244.3-240s21c1
Sequence:CCGGAGATTCCTGGAATAGACATACCTCGAGGTATGTCTATTCCAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018888
VALIDATED
UQCC MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase complex chaperone
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018888.1-387s1c1
Sequence:CCGGGAAGACTGACTTCGAGGAGTTCTCGAGAACTCCTCGAAGTCAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018888.1-637s1c1
Sequence:CCGGGCAGCAATCTTGGGATACGATCTCGAGATCGTATCCCAAGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018888.1-429s1c1
Sequence:CCGGCGATACATTCAACTCCTGGTTCTCGAGAACCAGGAGTTGAATGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018888.1-525s1c1
Sequence:CCGGCCGGATCATAGTTCATTTCATCTCGAGATGAAATGAACTATGATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018888.1-2102s1c1
Sequence:CCGGCCTTCATTGAACTTGCTATAACTCGAGTTATAGCAAGTTCAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018888.1-535s1c1
Sequence:CCGGGTTCATTTCATGTGGGAAGATCTCGAGATCTTCCCACATGAAATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018888.3-1491s21c1
Sequence:CCGGTGTGCTTGGAGCAGTTTATTACTCGAGTAATAAACTGCTCCAAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018888.3-886s21c1
Sequence:CCGGGCAGCAATCTTGGGATACGATCTCGAGATCGTATCCCAAGATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018888.2-762s1c1
Sequence:CCGGGTGAGGAAACAGATGCAATACCTCGAGGTATTGCATCTGTTTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217457    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018888.2-2190s1c1
Sequence:CCGGGCCGCCTTCTCAGTTTATTTACTCGAGTAAATAAACTGAGAAGGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018888.3-784s21c1
Sequence:CCGGGTTCATTTCATGTGGGAAGATCTCGAGATCTTCCCACATGAAATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018888.3-678s21c1
Sequence:CCGGCGATACATTCAACTCCTGGTTCTCGAGAACCAGGAGTTGAATGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018888
VALIDATED
UQCC MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase complex chaperone
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018888.1-387s1c1
Sequence:CCGGGAAGACTGACTTCGAGGAGTTCTCGAGAACTCCTCGAAGTCAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018888.1-637s1c1
Sequence:CCGGGCAGCAATCTTGGGATACGATCTCGAGATCGTATCCCAAGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018888.1-429s1c1
Sequence:CCGGCGATACATTCAACTCCTGGTTCTCGAGAACCAGGAGTTGAATGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018888.1-525s1c1
Sequence:CCGGCCGGATCATAGTTCATTTCATCTCGAGATGAAATGAACTATGATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018888.1-2102s1c1
Sequence:CCGGCCTTCATTGAACTTGCTATAACTCGAGTTATAGCAAGTTCAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018888.1-535s1c1
Sequence:CCGGGTTCATTTCATGTGGGAAGATCTCGAGATCTTCCCACATGAAATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018888.3-1491s21c1
Sequence:CCGGTGTGCTTGGAGCAGTTTATTACTCGAGTAATAAACTGCTCCAAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018888.3-886s21c1
Sequence:CCGGGCAGCAATCTTGGGATACGATCTCGAGATCGTATCCCAAGATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018888.2-762s1c1
Sequence:CCGGGTGAGGAAACAGATGCAATACCTCGAGGTATTGCATCTGTTTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217457    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018888.2-2190s1c1
Sequence:CCGGGCCGCCTTCTCAGTTTATTTACTCGAGTAAATAAACTGAGAAGGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018888.3-784s21c1
Sequence:CCGGGTTCATTTCATGTGGGAAGATCTCGAGATCTTCCCACATGAAATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018888.3-678s21c1
Sequence:CCGGCGATACATTCAACTCCTGGTTCTCGAGAACCAGGAGTTGAATGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018888
VALIDATED
UQCC MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase complex chaperone
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018888.1-387s1c1
Sequence:CCGGGAAGACTGACTTCGAGGAGTTCTCGAGAACTCCTCGAAGTCAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018888.1-637s1c1
Sequence:CCGGGCAGCAATCTTGGGATACGATCTCGAGATCGTATCCCAAGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018888.1-429s1c1
Sequence:CCGGCGATACATTCAACTCCTGGTTCTCGAGAACCAGGAGTTGAATGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018888.1-525s1c1
Sequence:CCGGCCGGATCATAGTTCATTTCATCTCGAGATGAAATGAACTATGATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018888.1-2102s1c1
Sequence:CCGGCCTTCATTGAACTTGCTATAACTCGAGTTATAGCAAGTTCAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018888.1-535s1c1
Sequence:CCGGGTTCATTTCATGTGGGAAGATCTCGAGATCTTCCCACATGAAATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018888.3-1491s21c1
Sequence:CCGGTGTGCTTGGAGCAGTTTATTACTCGAGTAATAAACTGCTCCAAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018888.3-886s21c1
Sequence:CCGGGCAGCAATCTTGGGATACGATCTCGAGATCGTATCCCAAGATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018888.2-762s1c1
Sequence:CCGGGTGAGGAAACAGATGCAATACCTCGAGGTATTGCATCTGTTTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217457    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018888.2-2190s1c1
Sequence:CCGGGCCGCCTTCTCAGTTTATTTACTCGAGTAAATAAACTGAGAAGGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018888.3-784s21c1
Sequence:CCGGGTTCATTTCATGTGGGAAGATCTCGAGATCTTCCCACATGAAATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018888.3-678s21c1
Sequence:CCGGCGATACATTCAACTCCTGGTTCTCGAGAACCAGGAGTTGAATGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks