EMAIL THIS PAGE TO A FRIEND

UQCR10

ubiquinol-cytochrome c reductase, complex III subunit X

Synonyms: HSPC051 HSPC151 QCR9 UCCR7.2 UCRC
UniProtKB ID: Q9UDW1, B5MCM5, Q9T2V6
Gene ID:
Human(29796) Summary: UCRC is a subunit of mitochondrial complex III (ubiquinol-cytochrome c reductase; EC 1.10.2.2), which forms the middle segment of the respiratory chain of the inner mitochondrial membrane (Schagger et al., 1995 [PubMed 8592474]
Mouse(66152) ubiquinol-cytochrome c reductase, complex III subunit X
Rat(100361126) ubiquinol-cytochrome c reductase, complex III subunit X
cow(616109) ubiquinol-cytochrome c reductase, complex III subunit X
chicken(770937) ubiquinol-cytochrome c reductase, complex III subunit X
dog(486347) ubiquinol-cytochrome c reductase, complex III subunit X
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102637 Anti-UCRC antibody produced in rabbit affinity isolated antibody mouse, pig, canine, bovine, human, rat, rabbit, guinea pig
western blot pricing
SAB1403213 Monoclonal Anti-UCRC antibody produced in mouse clone 2B5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013387 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_197979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_197979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_197979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003684 Rosetta Predictions human pricing
NM_013387 Rosetta Predictions human pricing
NM_197979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036984 predicted 448
2 SASI_Hs01_00036985 predicted 512
3 SASI_Hs01_00036986 predicted 493
4 SASI_Hs01_00036987 predicted 514
5 SASI_Hs01_00036988 predicted 534
6 SASI_Hs01_00036989 predicted 565
7 SASI_Hs01_00036990 predicted 507
8 SASI_Hs01_00036991 predicted 509
9 SASI_Hs01_00036992 predicted 529
10 SASI_Hs01_00036993 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163584 predicted 381
2 SASI_Hs01_00163585 predicted 451
3 SASI_Hs01_00163586 predicted 433
4 SASI_Hs01_00163587 predicted 456
5 SASI_Hs01_00163588 predicted 482
6 SASI_Hs01_00163589 predicted 500
7 SASI_Hs01_00163590 predicted 445
8 SASI_Hs01_00163591 predicted 446
9 SASI_Hs01_00163592 predicted 471
10 SASI_Hs01_00163593 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350661 predicted 204
2 SASI_Mm01_00122533 predicted 205
3 SASI_Mm02_00350662 predicted 209
4 SASI_Mm02_00350663 predicted 204
5 SASI_Mm01_00122535 predicted 333
6 SASI_Mm01_00122536 predicted 299
7 SASI_Mm01_00122537 predicted 328
8 SASI_Mm02_00350664 predicted 58
9 SASI_Mm01_00122538 predicted 373
10 SASI_Mm02_00350665 predicted 155
11 SASI_Mm01_00122534 predicted 179
12 SASI_Mm01_00122539 predicted 365
13 SASI_Mm01_00122540 predicted 363
14 SASI_Mm01_00122541 predicted 378
15 SASI_Mm01_00122542 predicted 379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013387
VALIDATED
UQCR10 MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase, complex III subunit X
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_013387.3-39s21c1
Sequence:CCGGCGCGACGTTGACTTCGAAATTCTCGAGAATTTCGAAGTCAACGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_013387.3-183s21c1
Sequence:CCGGGCTGTGGAAACACATCAAGCACTCGAGTGCTTGATGTGTTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_013387.3-153s21c1
Sequence:CCGGCGCTATCTACGACCACATCAACTCGAGTTGATGTGGTCGTAGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013387.3-103s21c1
Sequence:CCGGATCATCGTGGGCGTCATGTTCCTCGAGGAACATGACGCCCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_013387.3-342s21c1
Sequence:CCGGTGTTGGCAAGAAACGGCTTTACTCGAGTAAAGCCGTTTCTTGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_013387.2-153s1c1
Sequence:CCGGCGCTATCTACGACCACATCAACTCGAGTTGATGTGGTCGTAGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_013387.2-200s1c1
Sequence:CCGGAGCACAAGTATGAGAACAAGTCTCGAGACTTGTTCTCATACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_013387.2-189s1c1
Sequence:CCGGGAAACACATCAAGCACAAGTACTCGAGTACTTGTGCTTGATGTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_013387.2-183s1c1
Sequence:CCGGGCTGTGGAAACACATCAAGCACTCGAGTGCTTGATGTGTTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013387.2-65s1c1
Sequence:CCGGCCCTGCTGTTCCGCAGGACCTCTCGAGAGGTCCTGCGGAACAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013387
VALIDATED
UQCR10 MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase, complex III subunit X
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_013387.3-39s21c1
Sequence:CCGGCGCGACGTTGACTTCGAAATTCTCGAGAATTTCGAAGTCAACGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_013387.3-183s21c1
Sequence:CCGGGCTGTGGAAACACATCAAGCACTCGAGTGCTTGATGTGTTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_013387.3-153s21c1
Sequence:CCGGCGCTATCTACGACCACATCAACTCGAGTTGATGTGGTCGTAGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013387.3-103s21c1
Sequence:CCGGATCATCGTGGGCGTCATGTTCCTCGAGGAACATGACGCCCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_013387.3-342s21c1
Sequence:CCGGTGTTGGCAAGAAACGGCTTTACTCGAGTAAAGCCGTTTCTTGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_013387.2-153s1c1
Sequence:CCGGCGCTATCTACGACCACATCAACTCGAGTTGATGTGGTCGTAGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_013387.2-200s1c1
Sequence:CCGGAGCACAAGTATGAGAACAAGTCTCGAGACTTGTTCTCATACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_013387.2-189s1c1
Sequence:CCGGGAAACACATCAAGCACAAGTACTCGAGTACTTGTGCTTGATGTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_013387.2-183s1c1
Sequence:CCGGGCTGTGGAAACACATCAAGCACTCGAGTGCTTGATGTGTTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013387.2-65s1c1
Sequence:CCGGCCCTGCTGTTCCGCAGGACCTCTCGAGAGGTCCTGCGGAACAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013387
VALIDATED
UQCR10 MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase, complex III subunit X
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_013387.3-39s21c1
Sequence:CCGGCGCGACGTTGACTTCGAAATTCTCGAGAATTTCGAAGTCAACGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_013387.3-183s21c1
Sequence:CCGGGCTGTGGAAACACATCAAGCACTCGAGTGCTTGATGTGTTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_013387.3-153s21c1
Sequence:CCGGCGCTATCTACGACCACATCAACTCGAGTTGATGTGGTCGTAGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013387.3-103s21c1
Sequence:CCGGATCATCGTGGGCGTCATGTTCCTCGAGGAACATGACGCCCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_013387.3-342s21c1
Sequence:CCGGTGTTGGCAAGAAACGGCTTTACTCGAGTAAAGCCGTTTCTTGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_013387.2-153s1c1
Sequence:CCGGCGCTATCTACGACCACATCAACTCGAGTTGATGTGGTCGTAGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_013387.2-200s1c1
Sequence:CCGGAGCACAAGTATGAGAACAAGTCTCGAGACTTGTTCTCATACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_013387.2-189s1c1
Sequence:CCGGGAAACACATCAAGCACAAGTACTCGAGTACTTGTGCTTGATGTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_013387.2-183s1c1
Sequence:CCGGGCTGTGGAAACACATCAAGCACTCGAGTGCTTGATGTGTTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013387.2-65s1c1
Sequence:CCGGCCCTGCTGTTCCGCAGGACCTCTCGAGAGGTCCTGCGGAACAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197979
VALIDATED
UQCR10 MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase, complex III subunit X
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_197979.1-280s1c1
Sequence:CCGGCCTCAGCCTAAGGATGAGTTTCTCGAGAAACTCATCCTTAGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197979.1-110s1c1
Sequence:CCGGCTGTTCTTTGAGCGAGCCTTCCTCGAGGAAGGCTCGCTCAAAGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_197979.1-185s1c1
Sequence:CCGGCATATAAAGCACAAGTATGAGCTCGAGCTCATACTTGTGCTTTATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_197979.1-193s1c1
Sequence:CCGGGCACAAGTATGAGAACAAGGACTCGAGTCCTTGTTCTCATACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197979.1-178s1c1
Sequence:CCGGGTGGAAACATATAAAGCACAACTCGAGTTGTGCTTTATATGTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197979
VALIDATED
UQCR10 MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase, complex III subunit X
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_197979.1-280s1c1
Sequence:CCGGCCTCAGCCTAAGGATGAGTTTCTCGAGAAACTCATCCTTAGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197979.1-110s1c1
Sequence:CCGGCTGTTCTTTGAGCGAGCCTTCCTCGAGGAAGGCTCGCTCAAAGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_197979.1-185s1c1
Sequence:CCGGCATATAAAGCACAAGTATGAGCTCGAGCTCATACTTGTGCTTTATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_197979.1-193s1c1
Sequence:CCGGGCACAAGTATGAGAACAAGGACTCGAGTCCTTGTTCTCATACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197979.1-178s1c1
Sequence:CCGGGTGGAAACATATAAAGCACAACTCGAGTTGTGCTTTATATGTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197979
VALIDATED
UQCR10 MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase, complex III subunit X
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_197979.1-280s1c1
Sequence:CCGGCCTCAGCCTAAGGATGAGTTTCTCGAGAAACTCATCCTTAGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197979.1-110s1c1
Sequence:CCGGCTGTTCTTTGAGCGAGCCTTCCTCGAGGAAGGCTCGCTCAAAGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_197979.1-185s1c1
Sequence:CCGGCATATAAAGCACAAGTATGAGCTCGAGCTCATACTTGTGCTTTATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_197979.1-193s1c1
Sequence:CCGGGCACAAGTATGAGAACAAGGACTCGAGTCCTTGTTCTCATACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197979.1-178s1c1
Sequence:CCGGGTGGAAACATATAAAGCACAACTCGAGTTGTGCTTTATATGTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks