EMAIL THIS PAGE TO A FRIEND

UQCR11

ubiquinol-cytochrome c reductase, complex III subunit XI

Synonyms: 0710008D09Rik QCR10 UQCR
UniProtKB ID: O14957, B2R542, D6W5Z4, Q9UEA3, Q9UPK4
Gene ID:
Human(10975) Summary: This gene encodes the smallest known component of the ubiquinol-cytochrome c reductase complex, which forms part of the mitochondrial respiratory chain. The encoded protein may function as a binding factor for the iron-sulfur protein in this complex. [provided by RefSeq, Oct 2009]
Mouse(66594) ubiquinol-cytochrome c reductase, complex III subunit XI
Rat(690848) ubiquinol-cytochrome c reductase, complex III subunit XI
Zebrafish(100333135) ubiquinol-cytochrome c reductase, complex III subunit XI
chicken(770135) ubiquinol-cytochrome c reductase, complex III subunit XI
dog(611791) ubiquinol-cytochrome c reductase, complex III subunit XI
cow(281570) ubiquinol-cytochrome c reductase, complex III subunit XI
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006830 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025650 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025650 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025650 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006830 Rosetta Predictions human pricing
NM_001126097 Rosetta Predictions rat pricing
NM_025650 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194534 predicted 315
2 SASI_Hs01_00194535 predicted 317
3 SASI_Hs01_00194536 predicted 309
4 SASI_Hs01_00194537 predicted 274
5 SASI_Hs01_00194538 predicted 274
6 SASI_Hs01_00194542 predicted 304
7 SASI_Hs02_00342391 predicted 306
8 SASI_Hs01_00194539 predicted 296
9 SASI_Hs01_00194540 predicted 218
10 SASI_Hs01_00194541 predicted 227
11 SASI_Hs01_00194533 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252983 predicted 225
2 SASI_Rn02_00252984 predicted 226
3 SASI_Rn02_00252985 predicted 220
4 SASI_Rn02_00252986 predicted 230
5 SASI_Rn02_00252987 predicted 205
6 SASI_Rn02_00252988 predicted 237
7 SASI_Rn02_00252989 predicted 239
8 SASI_Rn02_00252990 predicted 222
9 SASI_Rn02_00252991 predicted 237
10 SASI_Rn02_00252992 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056937 predicted 200
2 SASI_Mm01_00056938 predicted 194
3 SASI_Mm01_00056939 predicted 207
4 SASI_Mm01_00056941 predicted 203
5 SASI_Mm01_00056942 predicted 205
6 SASI_Mm01_00056943 predicted 142
7 SASI_Mm01_00056944 predicted 109
8 SASI_Mm01_00056945 predicted 215
9 SASI_Mm01_00056946 predicted 388
10 SASI_Mm02_00328766 predicted 389
11 SASI_Mm01_00056940 predicted 204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006830
VALIDATED
UQCR11 MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase, complex III subunit XI
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006830.2-158s1c1
Sequence:CCGGACCTTACATCAATGGCAAGTTCTCGAGAACTTGCCATTGATGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006830.2-138s1c1
Sequence:CCGGCGGCTGATCCTGGACTGGGTACTCGAGTACCCAGTCCAGGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006830.2-164s1c1
Sequence:CCGGCATCAATGGCAAGTTTAAGAACTCGAGTTCTTAAACTTGCCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006830.2-61s1c1
Sequence:CCGGTGGTCAAGAACTGGGTCCCGACTCGAGTCGGGACCCAGTTCTTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006830.2-150s1c1
Sequence:CCGGGACTGGGTACCTTACATCAATCTCGAGATTGATGTAAGGTACCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006830.2-604s21c1
Sequence:CCGGGGCTTAAAGCAACGAACATTCCTCGAGGAATGTTCGTTGCTTTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006830.2-138s21c1
Sequence:CCGGCGGCTGATCCTGGACTGGGTACTCGAGTACCCAGTCCAGGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006830.2-164s21c1
Sequence:CCGGCATCAATGGCAAGTTTAAGAACTCGAGTTCTTAAACTTGCCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006830.2-52s21c1
Sequence:CCGGACCGGGAGCTGGTCAAGAACTCTCGAGAGTTCTTGACCAGCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006830.2-190s21c1
Sequence:CCGGATTAATTACACAAACCCTTCACTCGAGTGAAGGGTTTGTGTAATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006830
VALIDATED
UQCR11 MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase, complex III subunit XI
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006830.2-158s1c1
Sequence:CCGGACCTTACATCAATGGCAAGTTCTCGAGAACTTGCCATTGATGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006830.2-138s1c1
Sequence:CCGGCGGCTGATCCTGGACTGGGTACTCGAGTACCCAGTCCAGGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006830.2-164s1c1
Sequence:CCGGCATCAATGGCAAGTTTAAGAACTCGAGTTCTTAAACTTGCCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006830.2-61s1c1
Sequence:CCGGTGGTCAAGAACTGGGTCCCGACTCGAGTCGGGACCCAGTTCTTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006830.2-150s1c1
Sequence:CCGGGACTGGGTACCTTACATCAATCTCGAGATTGATGTAAGGTACCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006830.2-604s21c1
Sequence:CCGGGGCTTAAAGCAACGAACATTCCTCGAGGAATGTTCGTTGCTTTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006830.2-138s21c1
Sequence:CCGGCGGCTGATCCTGGACTGGGTACTCGAGTACCCAGTCCAGGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006830.2-164s21c1
Sequence:CCGGCATCAATGGCAAGTTTAAGAACTCGAGTTCTTAAACTTGCCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006830.2-52s21c1
Sequence:CCGGACCGGGAGCTGGTCAAGAACTCTCGAGAGTTCTTGACCAGCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006830.2-190s21c1
Sequence:CCGGATTAATTACACAAACCCTTCACTCGAGTGAAGGGTTTGTGTAATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006830
VALIDATED
UQCR11 MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase, complex III subunit XI
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006830.2-158s1c1
Sequence:CCGGACCTTACATCAATGGCAAGTTCTCGAGAACTTGCCATTGATGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006830.2-138s1c1
Sequence:CCGGCGGCTGATCCTGGACTGGGTACTCGAGTACCCAGTCCAGGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006830.2-164s1c1
Sequence:CCGGCATCAATGGCAAGTTTAAGAACTCGAGTTCTTAAACTTGCCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006830.2-61s1c1
Sequence:CCGGTGGTCAAGAACTGGGTCCCGACTCGAGTCGGGACCCAGTTCTTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006830.2-150s1c1
Sequence:CCGGGACTGGGTACCTTACATCAATCTCGAGATTGATGTAAGGTACCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006830.2-604s21c1
Sequence:CCGGGGCTTAAAGCAACGAACATTCCTCGAGGAATGTTCGTTGCTTTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006830.2-138s21c1
Sequence:CCGGCGGCTGATCCTGGACTGGGTACTCGAGTACCCAGTCCAGGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006830.2-164s21c1
Sequence:CCGGCATCAATGGCAAGTTTAAGAACTCGAGTTCTTAAACTTGCCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006830.2-52s21c1
Sequence:CCGGACCGGGAGCTGGTCAAGAACTCTCGAGAGTTCTTGACCAGCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006830.2-190s21c1
Sequence:CCGGATTAATTACACAAACCCTTCACTCGAGTGAAGGGTTTGTGTAATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025650
VALIDATED
UQCR11 MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase, complex III subunit XI
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025650.1-134s1c1
Sequence:CCGGCTGGATTCCCACAGCCGGCATCTCGAGATGCCGGCTGTGGGAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025650.1-221s1c1
Sequence:CCGGGCCTTACATCAACGGCAAGTTCTCGAGAACTTGCCGTTGATGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025650.1-126s1c1
Sequence:CCGGGCCAGAAACTGGATTCCCACACTCGAGTGTGGGAATCCAGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025650.1-235s1c1
Sequence:CCGGGCAAGTTTAAGAAGGACGATTCTCGAGAATCGTCCTTCTTAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025650.2-116s21c1
Sequence:CCGGGCCAGAAACTGGATTCCCACACTCGAGTGTGGGAATCCAGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025650.2-225s21c1
Sequence:CCGGGCAAGTTTAAGAAGGACGATTCTCGAGAATCGTCCTTCTTAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025650.2-211s21c1
Sequence:CCGGGCCTTACATCAACGGCAAGTTCTCGAGAACTTGCCGTTGATGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025650.2-201s21c1
Sequence:CCGGTGGACTGGGTGCCTTACATCACTCGAGTGATGTAAGGCACCCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025650.2-104s21c1
Sequence:CCGGTACCGGGAACTGGCCAGAAACCTCGAGGTTTCTGGCCAGTTCCCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025650
VALIDATED
UQCR11 MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase, complex III subunit XI
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025650.1-134s1c1
Sequence:CCGGCTGGATTCCCACAGCCGGCATCTCGAGATGCCGGCTGTGGGAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025650.1-221s1c1
Sequence:CCGGGCCTTACATCAACGGCAAGTTCTCGAGAACTTGCCGTTGATGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025650.1-126s1c1
Sequence:CCGGGCCAGAAACTGGATTCCCACACTCGAGTGTGGGAATCCAGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025650.1-235s1c1
Sequence:CCGGGCAAGTTTAAGAAGGACGATTCTCGAGAATCGTCCTTCTTAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025650.2-116s21c1
Sequence:CCGGGCCAGAAACTGGATTCCCACACTCGAGTGTGGGAATCCAGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025650.2-225s21c1
Sequence:CCGGGCAAGTTTAAGAAGGACGATTCTCGAGAATCGTCCTTCTTAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025650.2-211s21c1
Sequence:CCGGGCCTTACATCAACGGCAAGTTCTCGAGAACTTGCCGTTGATGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025650.2-201s21c1
Sequence:CCGGTGGACTGGGTGCCTTACATCACTCGAGTGATGTAAGGCACCCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025650.2-104s21c1
Sequence:CCGGTACCGGGAACTGGCCAGAAACCTCGAGGTTTCTGGCCAGTTCCCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025650
VALIDATED
UQCR11 MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase, complex III subunit XI
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025650.1-134s1c1
Sequence:CCGGCTGGATTCCCACAGCCGGCATCTCGAGATGCCGGCTGTGGGAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025650.1-221s1c1
Sequence:CCGGGCCTTACATCAACGGCAAGTTCTCGAGAACTTGCCGTTGATGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025650.1-126s1c1
Sequence:CCGGGCCAGAAACTGGATTCCCACACTCGAGTGTGGGAATCCAGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025650.1-235s1c1
Sequence:CCGGGCAAGTTTAAGAAGGACGATTCTCGAGAATCGTCCTTCTTAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025650.2-116s21c1
Sequence:CCGGGCCAGAAACTGGATTCCCACACTCGAGTGTGGGAATCCAGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025650.2-225s21c1
Sequence:CCGGGCAAGTTTAAGAAGGACGATTCTCGAGAATCGTCCTTCTTAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025650.2-211s21c1
Sequence:CCGGGCCTTACATCAACGGCAAGTTCTCGAGAACTTGCCGTTGATGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025650.2-201s21c1
Sequence:CCGGTGGACTGGGTGCCTTACATCACTCGAGTGATGTAAGGCACCCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025650.2-104s21c1
Sequence:CCGGTACCGGGAACTGGCCAGAAACCTCGAGGTTTCTGGCCAGTTCCCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks