EMAIL THIS PAGE TO A FRIEND

UQCRB

ubiquinol-cytochrome c reductase binding protein

Synonyms: MC3DN3 QCR7 QP-C QPC UQBC UQBP UQCR6 UQPC
UniProtKB ID: P14927, E5RJU0, Q6FGD1
Gene ID:
Human(7381) Summary: This gene encodes a subunit of the ubiquinol-cytochrome c oxidoreductase complex, which consists of one mitochondrial-encoded and 10 nuclear-encoded subunits. The protein encoded by this gene binds ubiquinone and participates in the transfer of electrons when ubiquinone is bound. This protein plays an important role in hypoxia-induced angiogenesis through mitochondrial reactive oxygen species-mediated signaling. Mutations in this gene are associated with mitochondrial complex III deficiency. Alternatively spliced transcript variants have been found for this gene. Related pseudogenes have been identified on chromosomes 1, 5 and X. [provided by RefSeq, Dec 2011]
Mouse(67530) ubiquinol-cytochrome c reductase binding protein
Rat(362897) ubiquinol-cytochrome c reductase binding protein
cow(616871) ubiquinol-cytochrome c reductase binding protein
Zebrafish(554154) ubiquinol-cytochrome c reductase binding protein
chicken(420236) ubiquinol-cytochrome c reductase binding protein
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026219 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026219 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026219 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006294 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106011 MISSION® esiRNA esiRNA human UQCRB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006294 Rosetta Predictions human pricing
NM_001127553 Rosetta Predictions rat pricing
NM_026219 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209706 predicted 724
2 SASI_Hs01_00209708 predicted 503
3 SASI_Hs01_00209710 predicted 569
4 SASI_Hs02_00341293 predicted 198
5 SASI_Hs02_00341294 predicted 713
6 SASI_Hs02_00341295 predicted 712
7 SASI_Hs02_00341296 predicted 547
8 SASI_Hs02_00341297 predicted 698
9 SASI_Hs02_00341298 predicted 722
10 SASI_Hs02_00341299 predicted 618
11 SASI_Hs01_00209707 predicted 700
12 SASI_Hs01_00209709 predicted 391
13 SASI_Hs01_00209711 predicted 203
14 SASI_Hs01_00209712 predicted 412
15 SASI_Hs01_00209713 predicted 374
16 SASI_Hs01_00209714 predicted 381
17 SASI_Hs01_00209715 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254283 predicted 439
2 SASI_Rn02_00254284 predicted 730
3 SASI_Rn02_00254285 predicted 518
4 SASI_Rn02_00254286 predicted 596
5 SASI_Rn02_00254287 predicted 492
6 SASI_Rn02_00254288 predicted 564
7 SASI_Rn02_00254289 predicted 680
8 SASI_Rn02_00254290 predicted 408
9 SASI_Rn02_00254291 predicted 431
10 SASI_Rn02_00254292 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026219 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069578 predicted 260
2 SASI_Mm01_00069580 predicted 203
3 SASI_Mm01_00069581 predicted 253
4 SASI_Mm02_00329891 predicted 239
5 SASI_Mm01_00069582 predicted 244
6 SASI_Mm01_00069583 predicted 205
7 SASI_Mm02_00329892 predicted 196
8 SASI_Mm02_00329893 predicted 204
9 SASI_Mm01_00069586 predicted 226
10 SASI_Mm01_00069587 predicted 233
11 SASI_Mm01_00069579 predicted 267
12 SASI_Mm01_00069584 predicted 233
13 SASI_Mm01_00069585 predicted 273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026219
VALIDATED
UQCRB MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase binding protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026219.1-267s21c1
Sequence:CCGGGCCTAAGGATCAGTGGACAAACTCGAGTTTGTCCACTGATCCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026219.1-295s21c1
Sequence:CCGGGAGGACAAATTCTACCTTGAACTCGAGTTCAAGGTAGAATTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026219.1-139s21c1
Sequence:CCGGCGAGATGATACACTACATGAACTCGAGTTCATGTAGTGTATCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026219.1-351s21c1
Sequence:CCGGGAGAGAAGAGTGGGCAAAGAACTCGAGTTCTTTGCCCACTCTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026219.1-267s1c1
Sequence:CCGGGCCTAAGGATCAGTGGACAAACTCGAGTTTGTCCACTGATCCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026219.1-351s1c1
Sequence:CCGGGAGAGAAGAGTGGGCAAAGAACTCGAGTTCTTTGCCCACTCTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026219.1-295s1c1
Sequence:CCGGGAGGACAAATTCTACCTTGAACTCGAGTTCAAGGTAGAATTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026219.1-243s1c1
Sequence:CCGGCCTGACTATGAGGCATCAGATCTCGAGATCTGATGCCTCATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026219.1-139s1c1
Sequence:CCGGCGAGATGATACACTACATGAACTCGAGTTCATGTAGTGTATCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026219
VALIDATED
UQCRB MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase binding protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026219.1-267s21c1
Sequence:CCGGGCCTAAGGATCAGTGGACAAACTCGAGTTTGTCCACTGATCCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026219.1-295s21c1
Sequence:CCGGGAGGACAAATTCTACCTTGAACTCGAGTTCAAGGTAGAATTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026219.1-139s21c1
Sequence:CCGGCGAGATGATACACTACATGAACTCGAGTTCATGTAGTGTATCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026219.1-351s21c1
Sequence:CCGGGAGAGAAGAGTGGGCAAAGAACTCGAGTTCTTTGCCCACTCTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026219.1-267s1c1
Sequence:CCGGGCCTAAGGATCAGTGGACAAACTCGAGTTTGTCCACTGATCCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026219.1-351s1c1
Sequence:CCGGGAGAGAAGAGTGGGCAAAGAACTCGAGTTCTTTGCCCACTCTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026219.1-295s1c1
Sequence:CCGGGAGGACAAATTCTACCTTGAACTCGAGTTCAAGGTAGAATTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026219.1-243s1c1
Sequence:CCGGCCTGACTATGAGGCATCAGATCTCGAGATCTGATGCCTCATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026219.1-139s1c1
Sequence:CCGGCGAGATGATACACTACATGAACTCGAGTTCATGTAGTGTATCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026219
VALIDATED
UQCRB MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase binding protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026219.1-267s21c1
Sequence:CCGGGCCTAAGGATCAGTGGACAAACTCGAGTTTGTCCACTGATCCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026219.1-295s21c1
Sequence:CCGGGAGGACAAATTCTACCTTGAACTCGAGTTCAAGGTAGAATTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026219.1-139s21c1
Sequence:CCGGCGAGATGATACACTACATGAACTCGAGTTCATGTAGTGTATCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026219.1-351s21c1
Sequence:CCGGGAGAGAAGAGTGGGCAAAGAACTCGAGTTCTTTGCCCACTCTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026219.1-267s1c1
Sequence:CCGGGCCTAAGGATCAGTGGACAAACTCGAGTTTGTCCACTGATCCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026219.1-351s1c1
Sequence:CCGGGAGAGAAGAGTGGGCAAAGAACTCGAGTTCTTTGCCCACTCTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026219.1-295s1c1
Sequence:CCGGGAGGACAAATTCTACCTTGAACTCGAGTTCAAGGTAGAATTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026219.1-243s1c1
Sequence:CCGGCCTGACTATGAGGCATCAGATCTCGAGATCTGATGCCTCATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026219.1-139s1c1
Sequence:CCGGCGAGATGATACACTACATGAACTCGAGTTCATGTAGTGTATCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006294
VALIDATED
UQCRB MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase binding protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006294.3-333s21c1
Sequence:CCGGCCTAAAGAGCAGTGGACCAAACTCGAGTTTGGTCCACTGCTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006294.3-250s21c1
Sequence:CCGGGAAGACTTCCTGAGAACCTTTCTCGAGAAAGGTTCTCAGGAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006294.3-275s21c1
Sequence:CCGGTGACAGGATGTTTCGCATTAACTCGAGTTAATGCGAAACATCCTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006294.3-210s21c1
Sequence:CCGGGATACAATATACGAGGATGAACTCGAGTTCATCCTCGTATATTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006294.2-199s1c1
Sequence:CCGGGAAGACTTCCTGAGAACCTTTCTCGAGAAAGGTTCTCAGGAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006294.2-282s1c1
Sequence:CCGGCCTAAAGAGCAGTGGACCAAACTCGAGTTTGGTCCACTGCTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006294.2-159s1c1
Sequence:CCGGGATACAATATACGAGGATGAACTCGAGTTCATCCTCGTATATTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006294.2-341s1c1
Sequence:CCGGAGAGGTTATTCGGGAAAGAAACTCGAGTTTCTTTCCCGAATAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006294.2-224s1c1
Sequence:CCGGTGACAGGATGTTTCGCATTAACTCGAGTTAATGCGAAACATCCTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006294
VALIDATED
UQCRB MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase binding protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006294.3-333s21c1
Sequence:CCGGCCTAAAGAGCAGTGGACCAAACTCGAGTTTGGTCCACTGCTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006294.3-250s21c1
Sequence:CCGGGAAGACTTCCTGAGAACCTTTCTCGAGAAAGGTTCTCAGGAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006294.3-275s21c1
Sequence:CCGGTGACAGGATGTTTCGCATTAACTCGAGTTAATGCGAAACATCCTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006294.3-210s21c1
Sequence:CCGGGATACAATATACGAGGATGAACTCGAGTTCATCCTCGTATATTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006294.2-199s1c1
Sequence:CCGGGAAGACTTCCTGAGAACCTTTCTCGAGAAAGGTTCTCAGGAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006294.2-282s1c1
Sequence:CCGGCCTAAAGAGCAGTGGACCAAACTCGAGTTTGGTCCACTGCTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006294.2-159s1c1
Sequence:CCGGGATACAATATACGAGGATGAACTCGAGTTCATCCTCGTATATTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006294.2-341s1c1
Sequence:CCGGAGAGGTTATTCGGGAAAGAAACTCGAGTTTCTTTCCCGAATAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006294.2-224s1c1
Sequence:CCGGTGACAGGATGTTTCGCATTAACTCGAGTTAATGCGAAACATCCTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006294
VALIDATED
UQCRB MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase binding protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006294.3-333s21c1
Sequence:CCGGCCTAAAGAGCAGTGGACCAAACTCGAGTTTGGTCCACTGCTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006294.3-250s21c1
Sequence:CCGGGAAGACTTCCTGAGAACCTTTCTCGAGAAAGGTTCTCAGGAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006294.3-275s21c1
Sequence:CCGGTGACAGGATGTTTCGCATTAACTCGAGTTAATGCGAAACATCCTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006294.3-210s21c1
Sequence:CCGGGATACAATATACGAGGATGAACTCGAGTTCATCCTCGTATATTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006294.2-199s1c1
Sequence:CCGGGAAGACTTCCTGAGAACCTTTCTCGAGAAAGGTTCTCAGGAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006294.2-282s1c1
Sequence:CCGGCCTAAAGAGCAGTGGACCAAACTCGAGTTTGGTCCACTGCTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006294.2-159s1c1
Sequence:CCGGGATACAATATACGAGGATGAACTCGAGTTCATCCTCGTATATTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006294.2-341s1c1
Sequence:CCGGAGAGGTTATTCGGGAAAGAAACTCGAGTTTCTTTCCCGAATAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006294.2-224s1c1
Sequence:CCGGTGACAGGATGTTTCGCATTAACTCGAGTTAATGCGAAACATCCTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks