EMAIL THIS PAGE TO A FRIEND

UQCRC1

ubiquinol-cytochrome c reductase core protein I

Synonyms: D3S3191 QCR1 UQCR1
UniProtKB ID: P31930, B2R7R8, Q96DD2
Gene ID:
Mouse(22273) ubiquinol-cytochrome c reductase core protein 1
Rat(301011) ubiquinol-cytochrome c reductase core protein I
Zebrafish(393793) ubiquinol-cytochrome c reductase core protein I
chicken(416013) ubiquinol-cytochrome c reductase core protein I
dog(608455) ubiquinol-cytochrome c reductase core protein I
Domestic Rabbit(100347571) ubiquinol-cytochrome c reductase core protein I
cow(282393) ubiquinol-cytochrome c reductase core protein I
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003365 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003365 Rosetta Predictions human pricing
NM_001004250 Rosetta Predictions rat pricing
NM_025407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121912 predicted 695
2 SASI_Hs01_00121913 predicted 1030
3 SASI_Hs02_00335516 predicted 1224
4 SASI_Hs01_00121915 predicted 489
5 SASI_Hs01_00121916 predicted 767
6 SASI_Hs02_00335517 predicted 850
7 SASI_Hs01_00121918 predicted 667
8 SASI_Hs01_00121919 predicted 1067
9 SASI_Hs01_00121920 predicted 868
10 SASI_Hs02_00335518 predicted 840
11 SASI_Hs01_00121911 predicted 1224
12 SASI_Hs01_00121914 predicted 542
13 SASI_Hs01_00121917 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043080 predicted 1179
2 SASI_Rn01_00043083 predicted 343
3 SASI_Rn01_00043084 predicted 535
4 SASI_Rn01_00043085 predicted 285
5 SASI_Rn01_00043086 predicted 525
6 SASI_Rn01_00043087 predicted 337
7 SASI_Rn01_00043088 predicted 1021
8 SASI_Rn01_00043089 predicted 496
9 SASI_Rn02_00198265 predicted 609
10 SASI_Rn02_00198266 predicted 259
11 SASI_Rn01_00043081 predicted 445
12 SASI_Rn01_00043082 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080885 predicted 1380
2 SASI_Mm01_00080886 predicted 1133
3 SASI_Mm01_00080887 predicted 1056
4 SASI_Mm01_00080888 predicted 996
5 SASI_Mm02_00328158 predicted 1388
6 SASI_Mm01_00080889 predicted 975
7 SASI_Mm01_00080890 predicted 606
8 SASI_Mm01_00080891 predicted 1249
9 SASI_Mm01_00080893 predicted 563
10 SASI_Mm01_00080894 predicted 324
11 SASI_Mm01_00080892 predicted 357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003365
VALIDATED
UQCRC1 MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase core protein I
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003365.2-426s1c1
Sequence:CCGGGCACACAGCTTACTACATCAACTCGAGTTGATGTAGTAAGCTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003365.2-517s1c1
Sequence:CCGGGACTCACAGATTGAGAAGGAACTCGAGTTCCTTCTCAATCTGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003365.2-1047s1c1
Sequence:CCGGCAACAAGCTATGCCAGAGTTTCTCGAGAAACTCTGGCATAGCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_003365.2-1144s1c1
Sequence:CCGGGACATGATGTTCGTCCTGCAACTCGAGTTGCAGGACGAACATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003365.2-696s1c1
Sequence:CCGGCGAGTACCTCAGCACACATTACTCGAGTAATGTGTGCTGAGGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003365.2-1376s21c1
Sequence:CCGGTCTGCTCCAAGTACATCTATGCTCGAGCATAGATGTACTTGGAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003365.2-968s21c1
Sequence:CCGGATGCCATCATCGGCCACTATGCTCGAGCATAGTGGCCGATGATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_003365.2-796s21c1
Sequence:CCGGGGTGGCATCCCATGGACATATCTCGAGATATGTCCATGGGATGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003365.2-579s21c1
Sequence:CCGGTATGCGAGATGTGGTCTTTAACTCGAGTTAAAGACCACATCTCGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003365.2-331s21c1
Sequence:CCGGCTGGCTTTCAAGGGAACAAAGCTCGAGCTTTGTTCCCTTGAAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003365
VALIDATED
UQCRC1 MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase core protein I
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003365.2-426s1c1
Sequence:CCGGGCACACAGCTTACTACATCAACTCGAGTTGATGTAGTAAGCTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003365.2-517s1c1
Sequence:CCGGGACTCACAGATTGAGAAGGAACTCGAGTTCCTTCTCAATCTGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003365.2-1047s1c1
Sequence:CCGGCAACAAGCTATGCCAGAGTTTCTCGAGAAACTCTGGCATAGCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_003365.2-1144s1c1
Sequence:CCGGGACATGATGTTCGTCCTGCAACTCGAGTTGCAGGACGAACATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003365.2-696s1c1
Sequence:CCGGCGAGTACCTCAGCACACATTACTCGAGTAATGTGTGCTGAGGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003365.2-1376s21c1
Sequence:CCGGTCTGCTCCAAGTACATCTATGCTCGAGCATAGATGTACTTGGAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003365.2-968s21c1
Sequence:CCGGATGCCATCATCGGCCACTATGCTCGAGCATAGTGGCCGATGATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_003365.2-796s21c1
Sequence:CCGGGGTGGCATCCCATGGACATATCTCGAGATATGTCCATGGGATGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003365.2-579s21c1
Sequence:CCGGTATGCGAGATGTGGTCTTTAACTCGAGTTAAAGACCACATCTCGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003365.2-331s21c1
Sequence:CCGGCTGGCTTTCAAGGGAACAAAGCTCGAGCTTTGTTCCCTTGAAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003365
VALIDATED
UQCRC1 MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase core protein I
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003365.2-426s1c1
Sequence:CCGGGCACACAGCTTACTACATCAACTCGAGTTGATGTAGTAAGCTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003365.2-517s1c1
Sequence:CCGGGACTCACAGATTGAGAAGGAACTCGAGTTCCTTCTCAATCTGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003365.2-1047s1c1
Sequence:CCGGCAACAAGCTATGCCAGAGTTTCTCGAGAAACTCTGGCATAGCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_003365.2-1144s1c1
Sequence:CCGGGACATGATGTTCGTCCTGCAACTCGAGTTGCAGGACGAACATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003365.2-696s1c1
Sequence:CCGGCGAGTACCTCAGCACACATTACTCGAGTAATGTGTGCTGAGGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003365.2-1376s21c1
Sequence:CCGGTCTGCTCCAAGTACATCTATGCTCGAGCATAGATGTACTTGGAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003365.2-968s21c1
Sequence:CCGGATGCCATCATCGGCCACTATGCTCGAGCATAGTGGCCGATGATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_003365.2-796s21c1
Sequence:CCGGGGTGGCATCCCATGGACATATCTCGAGATATGTCCATGGGATGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003365.2-579s21c1
Sequence:CCGGTATGCGAGATGTGGTCTTTAACTCGAGTTAAAGACCACATCTCGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003365.2-331s21c1
Sequence:CCGGCTGGCTTTCAAGGGAACAAAGCTCGAGCTTTGTTCCCTTGAAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025407
VALIDATED
UQCRC1 MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase core protein I
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025407.2-1394s1c1
Sequence:CCGGGCGTGACATTTGCTCCAAGTACTCGAGTACTTGGAGCAAATGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025407.2-1085s1c1
Sequence:CCGGCCAGAGTTTCCAGACCTTCAACTCGAGTTGAAGGTCTGGAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025407.2-452s1c1
Sequence:CCGGGCACACTGCTTACCTCATCAACTCGAGTTGATGAGGTAAGCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025407.2-554s1c1
Sequence:CCGGCGAGAAGGAACGAGATGTGATCTCGAGATCACATCTCGTTCCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025407.2-992s1c1
Sequence:CCGGCAATGCCATCATAGGCCACTACTCGAGTAGTGGCCTATGATGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025407.2-554s21c3
Sequence:CCGGCGAGAAGGAACGAGATGTGATCTCGAGATCACATCTCGTTCCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025407.2-1394s21c3
Sequence:CCGGGCGTGACATTTGCTCCAAGTACTCGAGTACTTGGAGCAAATGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025407.2-1085s21c3
Sequence:CCGGCCAGAGTTTCCAGACCTTCAACTCGAGTTGAAGGTCTGGAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025407.2-452s21c1
Sequence:CCGGGCACACTGCTTACCTCATCAACTCGAGTTGATGAGGTAAGCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025407
VALIDATED
UQCRC1 MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase core protein I
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025407.2-1394s1c1
Sequence:CCGGGCGTGACATTTGCTCCAAGTACTCGAGTACTTGGAGCAAATGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025407.2-1085s1c1
Sequence:CCGGCCAGAGTTTCCAGACCTTCAACTCGAGTTGAAGGTCTGGAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025407.2-452s1c1
Sequence:CCGGGCACACTGCTTACCTCATCAACTCGAGTTGATGAGGTAAGCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025407.2-554s1c1
Sequence:CCGGCGAGAAGGAACGAGATGTGATCTCGAGATCACATCTCGTTCCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025407.2-992s1c1
Sequence:CCGGCAATGCCATCATAGGCCACTACTCGAGTAGTGGCCTATGATGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025407.2-554s21c3
Sequence:CCGGCGAGAAGGAACGAGATGTGATCTCGAGATCACATCTCGTTCCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025407.2-1394s21c3
Sequence:CCGGGCGTGACATTTGCTCCAAGTACTCGAGTACTTGGAGCAAATGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025407.2-1085s21c3
Sequence:CCGGCCAGAGTTTCCAGACCTTCAACTCGAGTTGAAGGTCTGGAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025407.2-452s21c1
Sequence:CCGGGCACACTGCTTACCTCATCAACTCGAGTTGATGAGGTAAGCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025407
VALIDATED
UQCRC1 MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase core protein I
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025407.2-1394s1c1
Sequence:CCGGGCGTGACATTTGCTCCAAGTACTCGAGTACTTGGAGCAAATGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025407.2-1085s1c1
Sequence:CCGGCCAGAGTTTCCAGACCTTCAACTCGAGTTGAAGGTCTGGAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025407.2-452s1c1
Sequence:CCGGGCACACTGCTTACCTCATCAACTCGAGTTGATGAGGTAAGCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025407.2-554s1c1
Sequence:CCGGCGAGAAGGAACGAGATGTGATCTCGAGATCACATCTCGTTCCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025407.2-992s1c1
Sequence:CCGGCAATGCCATCATAGGCCACTACTCGAGTAGTGGCCTATGATGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025407.2-554s21c3
Sequence:CCGGCGAGAAGGAACGAGATGTGATCTCGAGATCACATCTCGTTCCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025407.2-1394s21c3
Sequence:CCGGGCGTGACATTTGCTCCAAGTACTCGAGTACTTGGAGCAAATGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025407.2-1085s21c3
Sequence:CCGGCCAGAGTTTCCAGACCTTCAACTCGAGTTGAAGGTCTGGAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025407.2-452s21c1
Sequence:CCGGGCACACTGCTTACCTCATCAACTCGAGTTGATGAGGTAAGCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks