EMAIL THIS PAGE TO A FRIEND

UQCRC2

ubiquinol-cytochrome c reductase core protein II

Synonyms: MC3DN5 QCR2 UQCR2
UniProtKB ID: P22695, B3KSN4, Q9BQ05
Gene ID:
Mouse(67003) ubiquinol cytochrome c reductase core protein 2
Rat(293448) ubiquinol cytochrome c reductase core protein 2
cow(282394) ubiquinol-cytochrome c reductase core protein II
Goat(100861263) ubiquinol-cytochrome-c reductase complex core protein 2
chicken(427009) ubiquinol-cytochrome c reductase core protein II
dog(479815) ubiquinol-cytochrome c reductase core protein II
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025899 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025899 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025899 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003366 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003366 Rosetta Predictions human pricing
NM_001006970 Rosetta Predictions rat pricing
NM_025899 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211208 predicted 694
2 SASI_Hs02_00335519 predicted 665
3 SASI_Hs01_00211209 predicted 1385
4 SASI_Hs01_00211210 predicted 791
5 SASI_Hs01_00211211 predicted 487
6 SASI_Hs01_00211212 predicted 1113
7 SASI_Hs01_00211213 predicted 1332
8 SASI_Hs01_00211214 predicted 349
9 SASI_Hs01_00211215 predicted 1102
10 SASI_Hs02_00335520 predicted 355
11 SASI_Hs01_00211206 predicted 1147
12 SASI_Hs01_00211207 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198525 predicted 231
2 SASI_Rn02_00198526 predicted 966
3 SASI_Rn02_00198527 predicted 780
4 SASI_Rn01_00078709 predicted 844
5 SASI_Rn01_00078710 predicted 200
6 SASI_Rn01_00078712 predicted 287
7 SASI_Rn01_00078713 predicted 548
8 SASI_Rn01_00078714 predicted 732
9 SASI_Rn01_00078715 predicted 457
10 SASI_Rn01_00078716 predicted 442
11 SASI_Rn01_00078711 predicted 633
12 SASI_Rn01_00078717 predicted 1003
13 SASI_Rn01_00078718 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167400 predicted 917
2 SASI_Mm01_00167401 predicted 946
3 SASI_Mm01_00167402 predicted 1172
4 SASI_Mm01_00167403 predicted 300
5 SASI_Mm01_00167404 predicted 254
6 SASI_Mm01_00167405 predicted 689
7 SASI_Mm01_00167406 predicted 300
8 SASI_Mm01_00167407 predicted 348
9 SASI_Mm01_00167409 predicted 340
10 SASI_Mm02_00329250 predicted 1099
11 SASI_Mm01_00167408 predicted 854
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025899
VALIDATED
UQCRC2 MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase core protein II
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025899.2-1158s21c1
Sequence:CCGGGCTGCCTACAACCAAGTCAAACTCGAGTTTGACTTGGTTGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025899.2-357s21c1
Sequence:CCGGGCATCTAGTTTGACTACCAAACTCGAGTTTGGTAGTCAAACTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025899.2-1420s21c1
Sequence:CCGGCGAGTGGAAACTTGGGACATACTCGAGTATGTCCCAAGTTTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025899.2-734s21c1
Sequence:CCGGCCACTTCACAAGTGCAAGAATCTCGAGATTCTTGCACTTGTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025899.1-1455s1c1
Sequence:CCGGGTGTATTTAAAGCTCAGCCCACTCGAGTGGGCTGAGCTTTAAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025899.1-1404s1c1
Sequence:CCGGCGAGTGGAAACTTGGGACATACTCGAGTATGTCCCAAGTTTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025899.1-1142s1c1
Sequence:CCGGGCTGCCTACAACCAAGTCAAACTCGAGTTTGACTTGGTTGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025899.1-341s1c1
Sequence:CCGGGCATCTAGTTTGACTACCAAACTCGAGTTTGGTAGTCAAACTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025899.1-718s1c1
Sequence:CCGGCCACTTCACAAGTGCAAGAATCTCGAGATTCTTGCACTTGTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025899
VALIDATED
UQCRC2 MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase core protein II
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025899.2-1158s21c1
Sequence:CCGGGCTGCCTACAACCAAGTCAAACTCGAGTTTGACTTGGTTGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025899.2-357s21c1
Sequence:CCGGGCATCTAGTTTGACTACCAAACTCGAGTTTGGTAGTCAAACTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025899.2-1420s21c1
Sequence:CCGGCGAGTGGAAACTTGGGACATACTCGAGTATGTCCCAAGTTTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025899.2-734s21c1
Sequence:CCGGCCACTTCACAAGTGCAAGAATCTCGAGATTCTTGCACTTGTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025899.1-1455s1c1
Sequence:CCGGGTGTATTTAAAGCTCAGCCCACTCGAGTGGGCTGAGCTTTAAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025899.1-1404s1c1
Sequence:CCGGCGAGTGGAAACTTGGGACATACTCGAGTATGTCCCAAGTTTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025899.1-1142s1c1
Sequence:CCGGGCTGCCTACAACCAAGTCAAACTCGAGTTTGACTTGGTTGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025899.1-341s1c1
Sequence:CCGGGCATCTAGTTTGACTACCAAACTCGAGTTTGGTAGTCAAACTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025899.1-718s1c1
Sequence:CCGGCCACTTCACAAGTGCAAGAATCTCGAGATTCTTGCACTTGTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025899
VALIDATED
UQCRC2 MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase core protein II
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025899.2-1158s21c1
Sequence:CCGGGCTGCCTACAACCAAGTCAAACTCGAGTTTGACTTGGTTGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025899.2-357s21c1
Sequence:CCGGGCATCTAGTTTGACTACCAAACTCGAGTTTGGTAGTCAAACTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025899.2-1420s21c1
Sequence:CCGGCGAGTGGAAACTTGGGACATACTCGAGTATGTCCCAAGTTTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025899.2-734s21c1
Sequence:CCGGCCACTTCACAAGTGCAAGAATCTCGAGATTCTTGCACTTGTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025899.1-1455s1c1
Sequence:CCGGGTGTATTTAAAGCTCAGCCCACTCGAGTGGGCTGAGCTTTAAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025899.1-1404s1c1
Sequence:CCGGCGAGTGGAAACTTGGGACATACTCGAGTATGTCCCAAGTTTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025899.1-1142s1c1
Sequence:CCGGGCTGCCTACAACCAAGTCAAACTCGAGTTTGACTTGGTTGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025899.1-341s1c1
Sequence:CCGGGCATCTAGTTTGACTACCAAACTCGAGTTTGGTAGTCAAACTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025899.1-718s1c1
Sequence:CCGGCCACTTCACAAGTGCAAGAATCTCGAGATTCTTGCACTTGTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003366
VALIDATED
UQCRC2 MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase core protein II
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003366.2-1184s21c1
Sequence:CCGGGTTATCAAGGCTGCCTATAATCTCGAGATTATAGGCAGCCTTGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003366.2-689s21c1
Sequence:CCGGGCCTTGGCTAATCCCTTGTATCTCGAGATACAAGGGATTAGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003366.2-1378s21c1
Sequence:CCGGGCAGATTGATTCAGTGGCTAACTCGAGTTAGCCACTGAATCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003366.2-642s21c1
Sequence:CCGGCGCAGACTCATGTCATTGAAACTCGAGTTTCAATGACATGAGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293761    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003366.2-1502s21c1
Sequence:CCGGTGATGCACACATTACAGGAGACTCGAGTCTCCTGTAATGTGTGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003366.1-606s1c1
Sequence:CCGGGCCTTGGCTAATCCCTTGTATCTCGAGATACAAGGGATTAGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003366.1-559s1c1
Sequence:CCGGCGCAGACTCATGTCATTGAAACTCGAGTTTCAATGACATGAGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003366.1-1295s1c1
Sequence:CCGGGCAGATTGATTCAGTGGCTAACTCGAGTTAGCCACTGAATCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_003366.1-1010s1c1
Sequence:CCGGGCCATTTGATGTTTCTGCATTCTCGAGAATGCAGAAACATCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003366.1-376s1c1
Sequence:CCGGGCAAATTAAGTGTGACCGCAACTCGAGTTGCGGTCACACTTAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003366
VALIDATED
UQCRC2 MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase core protein II
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003366.2-1184s21c1
Sequence:CCGGGTTATCAAGGCTGCCTATAATCTCGAGATTATAGGCAGCCTTGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003366.2-689s21c1
Sequence:CCGGGCCTTGGCTAATCCCTTGTATCTCGAGATACAAGGGATTAGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003366.2-1378s21c1
Sequence:CCGGGCAGATTGATTCAGTGGCTAACTCGAGTTAGCCACTGAATCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003366.2-642s21c1
Sequence:CCGGCGCAGACTCATGTCATTGAAACTCGAGTTTCAATGACATGAGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293761    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003366.2-1502s21c1
Sequence:CCGGTGATGCACACATTACAGGAGACTCGAGTCTCCTGTAATGTGTGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003366.1-606s1c1
Sequence:CCGGGCCTTGGCTAATCCCTTGTATCTCGAGATACAAGGGATTAGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003366.1-559s1c1
Sequence:CCGGCGCAGACTCATGTCATTGAAACTCGAGTTTCAATGACATGAGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003366.1-1295s1c1
Sequence:CCGGGCAGATTGATTCAGTGGCTAACTCGAGTTAGCCACTGAATCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_003366.1-1010s1c1
Sequence:CCGGGCCATTTGATGTTTCTGCATTCTCGAGAATGCAGAAACATCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003366.1-376s1c1
Sequence:CCGGGCAAATTAAGTGTGACCGCAACTCGAGTTGCGGTCACACTTAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003366
VALIDATED
UQCRC2 MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase core protein II
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003366.2-1184s21c1
Sequence:CCGGGTTATCAAGGCTGCCTATAATCTCGAGATTATAGGCAGCCTTGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003366.2-689s21c1
Sequence:CCGGGCCTTGGCTAATCCCTTGTATCTCGAGATACAAGGGATTAGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003366.2-1378s21c1
Sequence:CCGGGCAGATTGATTCAGTGGCTAACTCGAGTTAGCCACTGAATCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003366.2-642s21c1
Sequence:CCGGCGCAGACTCATGTCATTGAAACTCGAGTTTCAATGACATGAGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293761    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003366.2-1502s21c1
Sequence:CCGGTGATGCACACATTACAGGAGACTCGAGTCTCCTGTAATGTGTGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003366.1-606s1c1
Sequence:CCGGGCCTTGGCTAATCCCTTGTATCTCGAGATACAAGGGATTAGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003366.1-559s1c1
Sequence:CCGGCGCAGACTCATGTCATTGAAACTCGAGTTTCAATGACATGAGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003366.1-1295s1c1
Sequence:CCGGGCAGATTGATTCAGTGGCTAACTCGAGTTAGCCACTGAATCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_003366.1-1010s1c1
Sequence:CCGGGCCATTTGATGTTTCTGCATTCTCGAGAATGCAGAAACATCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003366.1-376s1c1
Sequence:CCGGGCAAATTAAGTGTGACCGCAACTCGAGTTGCGGTCACACTTAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks