EMAIL THIS PAGE TO A FRIEND

UQCRFS1

ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1

Synonyms: RIP1 RIS1 RISP UQCR5
UniProtKB ID: P47985, A8K519, Q6NVX5, Q9UPH2
Gene ID:
Mouse(66694) ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
Rat(291103) ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
Zebrafish(406359) ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
chicken(415752) ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
dog(476503) ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
cow(287020) ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006003 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006003 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006003 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025710 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025710 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025710 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106991 MISSION® esiRNA esiRNA human UQCRFS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006003 Rosetta Predictions human pricing
NM_001008888 Rosetta Predictions rat pricing
NM_025710 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049974 predicted 701
2 SASI_Hs01_00049975 predicted 773
3 SASI_Hs01_00049976 predicted 740
4 SASI_Hs01_00049977 predicted 893
5 SASI_Hs02_00340708 predicted 448
6 SASI_Hs02_00340709 predicted 316
7 SASI_Hs01_00049979 predicted 705
8 SASI_Hs01_00049980 predicted 445
9 SASI_Hs01_00049981 predicted 773
10 SASI_Hs01_00049982 predicted 895
11 SASI_Hs01_00049978 predicted 609
12 SASI_Hs01_00049983 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053347 predicted 312
2 SASI_Rn02_00199443 predicted 253
3 SASI_Rn01_00053348 predicted 617
4 SASI_Rn01_00053349 predicted 384
5 SASI_Rn01_00053350 predicted 515
6 SASI_Rn01_00053351 predicted 566
7 SASI_Rn01_00053352 predicted 645
8 SASI_Rn01_00053353 predicted 503
9 SASI_Rn01_00053354 predicted 681
10 SASI_Rn01_00053355 predicted 698
11 SASI_Rn01_00053356 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187049 predicted 521
2 SASI_Mm02_00328890 predicted 931
3 SASI_Mm02_00328891 predicted 411
4 SASI_Mm01_00187053 predicted 943
5 SASI_Mm01_00187055 predicted 326
6 SASI_Mm02_00328892 predicted 334
7 SASI_Mm02_00328893 predicted 516
8 SASI_Mm02_00328894 predicted 472
9 SASI_Mm01_00187048 predicted 910
10 SASI_Mm01_00187050 predicted 857
11 SASI_Mm01_00187051 predicted 667
12 SASI_Mm01_00187052 predicted 539
13 SASI_Mm01_00187054 predicted 589
14 SASI_Mm01_00187056 predicted 722
15 SASI_Mm01_00187057 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006003
VALIDATED
UQCRFS1 MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006003.1-546s1c1
Sequence:CCGGCGAAATCAAGTTATCCGATATCTCGAGATATCGGATAACTTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006003.1-761s1c1
Sequence:CCGGCCATTGCAAATGCAGGAGATTCTCGAGAATCTCCTGCATTTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006003.1-608s1c1
Sequence:CCGGCCCTGTTTGTGCGTCATAGAACTCGAGTTCTATGACGCACAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006003.1-889s1c1
Sequence:CCGGAGTGACGATATGGTGATTGTTCTCGAGAACAATCACCATATCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006003.1-431s1c1
Sequence:CCGGCCTATTTGGTAACTGGAGTAACTCGAGTTACTCCAGTTACCAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006003.2-629s21c1
Sequence:CCGGCCCTGTTTGTGCGTCATAGAACTCGAGTTCTATGACGCACAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006003.2-977s21c1
Sequence:CCGGGTCACCTCAGGAGACTTATTTCTCGAGAAATAAGTCTCCTGAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006003.2-741s21c1
Sequence:CCGGGGTTATCCTGATAGGTGTTTGCTCGAGCAAACACCTATCAGGATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006003.2-708s21c1
Sequence:CCGGGCATGATCTAGATCGAGTAAACTCGAGTTTACTCGATCTAGATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006003.2-567s21c1
Sequence:CCGGCGAAATCAAGTTATCCGATATCTCGAGATATCGGATAACTTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006003
VALIDATED
UQCRFS1 MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006003.1-546s1c1
Sequence:CCGGCGAAATCAAGTTATCCGATATCTCGAGATATCGGATAACTTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006003.1-761s1c1
Sequence:CCGGCCATTGCAAATGCAGGAGATTCTCGAGAATCTCCTGCATTTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006003.1-608s1c1
Sequence:CCGGCCCTGTTTGTGCGTCATAGAACTCGAGTTCTATGACGCACAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006003.1-889s1c1
Sequence:CCGGAGTGACGATATGGTGATTGTTCTCGAGAACAATCACCATATCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006003.1-431s1c1
Sequence:CCGGCCTATTTGGTAACTGGAGTAACTCGAGTTACTCCAGTTACCAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006003.2-629s21c1
Sequence:CCGGCCCTGTTTGTGCGTCATAGAACTCGAGTTCTATGACGCACAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006003.2-977s21c1
Sequence:CCGGGTCACCTCAGGAGACTTATTTCTCGAGAAATAAGTCTCCTGAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006003.2-741s21c1
Sequence:CCGGGGTTATCCTGATAGGTGTTTGCTCGAGCAAACACCTATCAGGATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006003.2-708s21c1
Sequence:CCGGGCATGATCTAGATCGAGTAAACTCGAGTTTACTCGATCTAGATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006003.2-567s21c1
Sequence:CCGGCGAAATCAAGTTATCCGATATCTCGAGATATCGGATAACTTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006003
VALIDATED
UQCRFS1 MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006003.1-546s1c1
Sequence:CCGGCGAAATCAAGTTATCCGATATCTCGAGATATCGGATAACTTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006003.1-761s1c1
Sequence:CCGGCCATTGCAAATGCAGGAGATTCTCGAGAATCTCCTGCATTTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006003.1-608s1c1
Sequence:CCGGCCCTGTTTGTGCGTCATAGAACTCGAGTTCTATGACGCACAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006003.1-889s1c1
Sequence:CCGGAGTGACGATATGGTGATTGTTCTCGAGAACAATCACCATATCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006003.1-431s1c1
Sequence:CCGGCCTATTTGGTAACTGGAGTAACTCGAGTTACTCCAGTTACCAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006003.2-629s21c1
Sequence:CCGGCCCTGTTTGTGCGTCATAGAACTCGAGTTCTATGACGCACAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006003.2-977s21c1
Sequence:CCGGGTCACCTCAGGAGACTTATTTCTCGAGAAATAAGTCTCCTGAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006003.2-741s21c1
Sequence:CCGGGGTTATCCTGATAGGTGTTTGCTCGAGCAAACACCTATCAGGATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006003.2-708s21c1
Sequence:CCGGGCATGATCTAGATCGAGTAAACTCGAGTTTACTCGATCTAGATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006003.2-567s21c1
Sequence:CCGGCGAAATCAAGTTATCCGATATCTCGAGATATCGGATAACTTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025710
VALIDATED
UQCRFS1 MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025710.1-669s1c1
Sequence:CCGGGCATGATTTAGATCGAGTAAACTCGAGTTTACTCGATCTAAATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025710.1-528s1c1
Sequence:CCGGCGAGATCAAGTTGTCTGATATCTCGAGATATCAGACAACTTGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025710.1-1129s1c1
Sequence:CCGGGCAATGTCTTTGATAGCTAATCTCGAGATTAGCTATCAAAGACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025710.1-603s1c1
Sequence:CCGGCCATAGAACCAAGAAGGAGATCTCGAGATCTCCTTCTTGGTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025710.1-346s1c1
Sequence:CCGGCGTCGTGCTGAAGTTCTTGATCTCGAGATCAAGAACTTCAGCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025710.2-1126s21c2
Sequence:CCGGGCAATGTCTTTGATAGCTAATCTCGAGATTAGCTATCAAAGACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025710.2-600s21c1
Sequence:CCGGCCATAGAACCAAGAAGGAGATCTCGAGATCTCCTTCTTGGTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025710.2-666s21c1
Sequence:CCGGGCATGATTTAGATCGAGTAAACTCGAGTTTACTCGATCTAAATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025710.2-343s21c1
Sequence:CCGGCGTCGTGCTGAAGTTCTTGATCTCGAGATCAAGAACTTCAGCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025710.2-525s21c2
Sequence:CCGGCGAGATCAAGTTGTCTGATATCTCGAGATATCAGACAACTTGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025710
VALIDATED
UQCRFS1 MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025710.1-669s1c1
Sequence:CCGGGCATGATTTAGATCGAGTAAACTCGAGTTTACTCGATCTAAATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025710.1-528s1c1
Sequence:CCGGCGAGATCAAGTTGTCTGATATCTCGAGATATCAGACAACTTGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025710.1-1129s1c1
Sequence:CCGGGCAATGTCTTTGATAGCTAATCTCGAGATTAGCTATCAAAGACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025710.1-603s1c1
Sequence:CCGGCCATAGAACCAAGAAGGAGATCTCGAGATCTCCTTCTTGGTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025710.1-346s1c1
Sequence:CCGGCGTCGTGCTGAAGTTCTTGATCTCGAGATCAAGAACTTCAGCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025710.2-1126s21c2
Sequence:CCGGGCAATGTCTTTGATAGCTAATCTCGAGATTAGCTATCAAAGACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025710.2-600s21c1
Sequence:CCGGCCATAGAACCAAGAAGGAGATCTCGAGATCTCCTTCTTGGTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025710.2-666s21c1
Sequence:CCGGGCATGATTTAGATCGAGTAAACTCGAGTTTACTCGATCTAAATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025710.2-343s21c1
Sequence:CCGGCGTCGTGCTGAAGTTCTTGATCTCGAGATCAAGAACTTCAGCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025710.2-525s21c2
Sequence:CCGGCGAGATCAAGTTGTCTGATATCTCGAGATATCAGACAACTTGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025710
VALIDATED
UQCRFS1 MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025710.1-669s1c1
Sequence:CCGGGCATGATTTAGATCGAGTAAACTCGAGTTTACTCGATCTAAATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025710.1-528s1c1
Sequence:CCGGCGAGATCAAGTTGTCTGATATCTCGAGATATCAGACAACTTGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025710.1-1129s1c1
Sequence:CCGGGCAATGTCTTTGATAGCTAATCTCGAGATTAGCTATCAAAGACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025710.1-603s1c1
Sequence:CCGGCCATAGAACCAAGAAGGAGATCTCGAGATCTCCTTCTTGGTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025710.1-346s1c1
Sequence:CCGGCGTCGTGCTGAAGTTCTTGATCTCGAGATCAAGAACTTCAGCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025710.2-1126s21c2
Sequence:CCGGGCAATGTCTTTGATAGCTAATCTCGAGATTAGCTATCAAAGACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025710.2-600s21c1
Sequence:CCGGCCATAGAACCAAGAAGGAGATCTCGAGATCTCCTTCTTGGTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025710.2-666s21c1
Sequence:CCGGGCATGATTTAGATCGAGTAAACTCGAGTTTACTCGATCTAAATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025710.2-343s21c1
Sequence:CCGGCGTCGTGCTGAAGTTCTTGATCTCGAGATCAAGAACTTCAGCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025710.2-525s21c2
Sequence:CCGGCGAGATCAAGTTGTCTGATATCTCGAGATATCAGACAACTTGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks