EMAIL THIS PAGE TO A FRIEND

UQCRH

ubiquinol-cytochrome c reductase hinge protein

Synonyms: QCR6 UQCR8
UniProtKB ID: P07919, B2R4V9, D3DQ18, Q5TDF6, Q6LDB8, Q9BQ91
Gene ID:
Mouse(66576) ubiquinol-cytochrome c reductase hinge protein
Rat(366448) ubiquinol-cytochrome c reductase hinge protein
Zebrafish(566723) ubiquinol-cytochrome c reductase hinge protein
dog(608530) ubiquinol-cytochrome c reductase hinge protein
chicken(771939) ubiquinol-cytochrome c reductase hinge protein
cow(613899) ubiquinol-cytochrome c reductase hinge protein
sheep(100270719) ubiquinol-cytochrome c reductase hinge protein
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301765 Anti-UQCRH affinity isolated antibody mouse, human
western blot pricing
SAB1402957 Monoclonal Anti-UQCRH antibody produced in mouse clone 1D7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006004 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025641 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025641 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025641 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009480 Rosetta Predictions rat pricing
NM_025641 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051348 predicted 317
2 SASI_Rn01_00051349 predicted 210
3 SASI_Rn01_00051350 predicted 259
4 SASI_Rn02_00199554 predicted 306
5 SASI_Rn01_00051352 predicted 199
6 SASI_Rn01_00051353 predicted 259
7 SASI_Rn01_00051354 predicted 318
8 SASI_Rn01_00051355 predicted 257
9 SASI_Rn01_00051356 predicted 246
10 SASI_Rn02_00199555 predicted 260
11 SASI_Rn01_00051351 predicted 224
12 SASI_Rn01_00051357 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130358 predicted 225
2 SASI_Mm01_00130361 predicted 223
3 SASI_Mm01_00130365 predicted 247
4 SASI_Mm01_00130366 predicted 296
5 SASI_Mm02_00328730 predicted 233
6 SASI_Mm01_00130363 predicted 268
7 SASI_Mm02_00328731 predicted 303
8 SASI_Mm02_00328732 predicted 231
9 SASI_Mm02_00328733 predicted 433
10 SASI_Mm01_00130357 predicted 249
11 SASI_Mm01_00130359 predicted 244
12 SASI_Mm01_00130360 predicted 256
13 SASI_Mm01_00130362 predicted 239
14 SASI_Mm01_00130364 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006004
UQCRH MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase hinge protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006004.2-256s21c1
Sequence:CCGGATTGCACGGAGGAGCTCTTTGCTCGAGCAAAGAGCTCCTCCGTGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006004.2-223s21c1
Sequence:CCGGAGCGTGTATCCTCTCGATCACCTCGAGGTGATCGAGAGGATACACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006004.2-332s21c1
Sequence:CCGGATAAATGTGTGGACTTAATTCCTCGAGGAATTAAGTCCACACATTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006004.1-150s1c1
Sequence:CCGGGCAGTTGGAGAAATGTGTAAACTCGAGTTTACACATTTCTCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006004.1-188s1c1
Sequence:CCGGAGCTCTGTGATGAGCGTGATTCTCGAGAATCACGCTCATCACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006004.1-285s1c1
Sequence:CCGGCCACAAACTCTTTAACAACTTCTCGAGAAGTTGTTAAAGAGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006004.1-203s1c1
Sequence:CCGGGTGATTCCTCTCGATCACATACTCGAGTATGTGATCGAGAGGAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006004.1-64s1c1
Sequence:CCGGCTTACCGAATCCGGAGATCCTCTCGAGAGGATCTCCGGATTCGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006004
UQCRH MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase hinge protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006004.2-256s21c1
Sequence:CCGGATTGCACGGAGGAGCTCTTTGCTCGAGCAAAGAGCTCCTCCGTGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006004.2-223s21c1
Sequence:CCGGAGCGTGTATCCTCTCGATCACCTCGAGGTGATCGAGAGGATACACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006004.2-332s21c1
Sequence:CCGGATAAATGTGTGGACTTAATTCCTCGAGGAATTAAGTCCACACATTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006004.1-150s1c1
Sequence:CCGGGCAGTTGGAGAAATGTGTAAACTCGAGTTTACACATTTCTCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006004.1-188s1c1
Sequence:CCGGAGCTCTGTGATGAGCGTGATTCTCGAGAATCACGCTCATCACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006004.1-285s1c1
Sequence:CCGGCCACAAACTCTTTAACAACTTCTCGAGAAGTTGTTAAAGAGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006004.1-203s1c1
Sequence:CCGGGTGATTCCTCTCGATCACATACTCGAGTATGTGATCGAGAGGAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006004.1-64s1c1
Sequence:CCGGCTTACCGAATCCGGAGATCCTCTCGAGAGGATCTCCGGATTCGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006004
UQCRH MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase hinge protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006004.2-256s21c1
Sequence:CCGGATTGCACGGAGGAGCTCTTTGCTCGAGCAAAGAGCTCCTCCGTGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006004.2-223s21c1
Sequence:CCGGAGCGTGTATCCTCTCGATCACCTCGAGGTGATCGAGAGGATACACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006004.2-332s21c1
Sequence:CCGGATAAATGTGTGGACTTAATTCCTCGAGGAATTAAGTCCACACATTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006004.1-150s1c1
Sequence:CCGGGCAGTTGGAGAAATGTGTAAACTCGAGTTTACACATTTCTCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006004.1-188s1c1
Sequence:CCGGAGCTCTGTGATGAGCGTGATTCTCGAGAATCACGCTCATCACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006004.1-285s1c1
Sequence:CCGGCCACAAACTCTTTAACAACTTCTCGAGAAGTTGTTAAAGAGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006004.1-203s1c1
Sequence:CCGGGTGATTCCTCTCGATCACATACTCGAGTATGTGATCGAGAGGAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006004.1-64s1c1
Sequence:CCGGCTTACCGAATCCGGAGATCCTCTCGAGAGGATCTCCGGATTCGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025641
VALIDATED
UQCRH MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase hinge protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025641.3-186s21c1
Sequence:CCGGACAACAGTGAGAGAGCACTGTCTCGAGACAGTGCTCTCTCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025641.3-240s21c1
Sequence:CCGGCGACTAGAGTTGTGTGATAATCTCGAGATTATCACACAACTCTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025641.3-391s21c1
Sequence:CCGGTCAGCCTTGTCACTGGGAATCCTCGAGGATTCCCAGTGACAAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025641.3-147s21c1
Sequence:CCGGCCCAAAGAGGAAGAAGAGGAACTCGAGTTCCTCTTCTTCCTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025641.2-164s1c1
Sequence:CCGGACAACAGTGAGAGAGCACTGTCTCGAGACAGTGCTCTCTCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025641.2-125s1c1
Sequence:CCGGCCCAAAGAGGAAGAAGAGGAACTCGAGTTCCTCTTCTTCCTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025641.2-251s1c1
Sequence:CCGGCGGTCACAGACAGAAGAGGATCTCGAGATCCTCTTCTGTCTGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025641.2-228s1c1
Sequence:CCGGTGTGTGATAATCGCGTGTCTTCTCGAGAAGACACGCGATTATCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025641.2-218s1c1
Sequence:CCGGCGACTAGAGTTGTGTGATAATCTCGAGATTATCACACAACTCTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025641
VALIDATED
UQCRH MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase hinge protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025641.3-186s21c1
Sequence:CCGGACAACAGTGAGAGAGCACTGTCTCGAGACAGTGCTCTCTCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025641.3-240s21c1
Sequence:CCGGCGACTAGAGTTGTGTGATAATCTCGAGATTATCACACAACTCTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025641.3-391s21c1
Sequence:CCGGTCAGCCTTGTCACTGGGAATCCTCGAGGATTCCCAGTGACAAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025641.3-147s21c1
Sequence:CCGGCCCAAAGAGGAAGAAGAGGAACTCGAGTTCCTCTTCTTCCTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025641.2-164s1c1
Sequence:CCGGACAACAGTGAGAGAGCACTGTCTCGAGACAGTGCTCTCTCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025641.2-125s1c1
Sequence:CCGGCCCAAAGAGGAAGAAGAGGAACTCGAGTTCCTCTTCTTCCTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025641.2-251s1c1
Sequence:CCGGCGGTCACAGACAGAAGAGGATCTCGAGATCCTCTTCTGTCTGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025641.2-228s1c1
Sequence:CCGGTGTGTGATAATCGCGTGTCTTCTCGAGAAGACACGCGATTATCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025641.2-218s1c1
Sequence:CCGGCGACTAGAGTTGTGTGATAATCTCGAGATTATCACACAACTCTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025641
VALIDATED
UQCRH MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase hinge protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025641.3-186s21c1
Sequence:CCGGACAACAGTGAGAGAGCACTGTCTCGAGACAGTGCTCTCTCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025641.3-240s21c1
Sequence:CCGGCGACTAGAGTTGTGTGATAATCTCGAGATTATCACACAACTCTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025641.3-391s21c1
Sequence:CCGGTCAGCCTTGTCACTGGGAATCCTCGAGGATTCCCAGTGACAAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025641.3-147s21c1
Sequence:CCGGCCCAAAGAGGAAGAAGAGGAACTCGAGTTCCTCTTCTTCCTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025641.2-164s1c1
Sequence:CCGGACAACAGTGAGAGAGCACTGTCTCGAGACAGTGCTCTCTCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025641.2-125s1c1
Sequence:CCGGCCCAAAGAGGAAGAAGAGGAACTCGAGTTCCTCTTCTTCCTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025641.2-251s1c1
Sequence:CCGGCGGTCACAGACAGAAGAGGATCTCGAGATCCTCTTCTGTCTGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025641.2-228s1c1
Sequence:CCGGTGTGTGATAATCGCGTGTCTTCTCGAGAAGACACGCGATTATCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025641.2-218s1c1
Sequence:CCGGCGACTAGAGTTGTGTGATAATCTCGAGATTATCACACAACTCTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks