EMAIL THIS PAGE TO A FRIEND

UQCRQ

ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa

Synonyms: MC3DN4 QCR8 QP-C QPC UQCR7
UniProtKB ID: O14949, Q5FVE2, Q9BV88, Q9T2V7
Gene ID:
Human(27089) Summary: This gene encodes a ubiquinone-binding protein of low molecular mass. This protein is a small core-associated protein and a subunit of ubiquinol-cytochrome c reductase complex III, which is part of the mitochondrial respiratory chain. [provided by RefSeq, Jul 2008]
Mouse(22272) ubiquinol-cytochrome c reductase, complex III subunit VII
Rat(497902) ubiquinol-cytochrome c reductase, complex III subunit VII
Zebrafish(436768) ubiquinol-cytochrome c reductase, complex III subunit VII
dog(609744) ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa
chicken(416336) ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa
Domestic Rabbit(100338219) ubiquinol-cytochrome c reductase, complex III subunit VII
cow(286885) ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025352 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025352 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025352 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014402 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014402 Rosetta Predictions human pricing
NM_001025134 Rosetta Predictions rat pricing
NM_025352 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079924 predicted 424
2 SASI_Hs01_00079925 predicted 326
3 SASI_Hs02_00345588 predicted 399
4 SASI_Hs01_00079926 predicted 264
5 SASI_Hs02_00345589 predicted 381
6 SASI_Hs01_00079927 predicted 255
7 SASI_Hs02_00345590 predicted 370
8 SASI_Hs01_00079928 predicted 336
9 SASI_Hs01_00079929 predicted 407
10 SASI_Hs01_00079930 predicted 256
11 SASI_Hs01_00079931 predicted 206
12 SASI_Hs01_00079932 predicted 336
13 SASI_Hs01_00079933 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115724 predicted 804
2 SASI_Rn01_00115725 predicted 465
3 SASI_Rn01_00115727 predicted 619
4 SASI_Rn01_00115728 predicted 453
5 SASI_Rn01_00115729 predicted 814
6 SASI_Rn02_00203055 predicted 262
7 SASI_Rn01_00115732 predicted 789
8 SASI_Rn01_00115733 predicted 196
9 SASI_Rn02_00203056 predicted 330
10 SASI_Rn02_00203057 predicted 837
11 SASI_Rn01_00115726 predicted 277
12 SASI_Rn01_00115730 predicted 470
13 SASI_Rn01_00115731 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328022 predicted 207
2 SASI_Mm02_00328023 predicted 209
3 SASI_Mm02_00328024 predicted 207
4 SASI_Mm02_00328025 predicted 206
5 SASI_Mm02_00328026 predicted 206
6 SASI_Mm02_00328027 predicted 204
7 SASI_Mm02_00328028 predicted 257
8 SASI_Mm02_00328029 predicted 254
9 SASI_Mm02_00328030 predicted 226
10 SASI_Mm02_00328031 predicted 205
11 SASI_Mm01_00081025 predicted 446
12 SASI_Mm01_00081026 predicted 462
13 SASI_Mm01_00081027 predicted 468
14 SASI_Mm01_00081028 predicted 429
15 SASI_Mm01_00081029 predicted 275
16 SASI_Mm01_00081030 predicted 844
17 SASI_Mm01_00081031 predicted 324
18 SASI_Mm01_00081032 predicted 781
19 SASI_Mm01_00081033 predicted 630
20 SASI_Mm01_00081034 predicted 412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025352
VALIDATED
UQCRQ MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025352.2-215s21c1
Sequence:CCGGCGCGCCTTCCCAAGCTATTTCCTCGAGGAAATAGCTTGGGAAGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025352.2-335s21c1
Sequence:CCGGCAGGAGTTTGAGCAGTCGAAACTCGAGTTTCGACTGCTCAAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025352.2-301s21c1
Sequence:CCGGTGTAGTGGTCTACCTGATCTACTCGAGTAGATCAGGTAGACCACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025352.2-188s21c1
Sequence:CCGGTCCTACAGCTTGTCGCCCTTTCTCGAGAAAGGGCGACAAGCTGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025352.1-805s1c1
Sequence:CCGGGCAGCCTTTGAAGTAAGCATTCTCGAGAATGCTTACTTCAAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025352.1-283s1c1
Sequence:CCGGTGTAGTGGTCTACCTGATCTACTCGAGTAGATCAGGTAGACCACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025352.1-170s1c1
Sequence:CCGGTCCTACAGCTTGTCGCCCTTTCTCGAGAAAGGGCGACAAGCTGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025352.1-207s1c1
Sequence:CCGGCAAGCTATTTCAGCAAAGGCACTCGAGTGCCTTTGCTGAAATAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025352.1-317s1c1
Sequence:CCGGCAGGAGTTTGAGCAGTCGAAACTCGAGTTTCGACTGCTCAAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025352
VALIDATED
UQCRQ MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025352.2-215s21c1
Sequence:CCGGCGCGCCTTCCCAAGCTATTTCCTCGAGGAAATAGCTTGGGAAGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025352.2-335s21c1
Sequence:CCGGCAGGAGTTTGAGCAGTCGAAACTCGAGTTTCGACTGCTCAAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025352.2-301s21c1
Sequence:CCGGTGTAGTGGTCTACCTGATCTACTCGAGTAGATCAGGTAGACCACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025352.2-188s21c1
Sequence:CCGGTCCTACAGCTTGTCGCCCTTTCTCGAGAAAGGGCGACAAGCTGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025352.1-805s1c1
Sequence:CCGGGCAGCCTTTGAAGTAAGCATTCTCGAGAATGCTTACTTCAAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025352.1-283s1c1
Sequence:CCGGTGTAGTGGTCTACCTGATCTACTCGAGTAGATCAGGTAGACCACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025352.1-170s1c1
Sequence:CCGGTCCTACAGCTTGTCGCCCTTTCTCGAGAAAGGGCGACAAGCTGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025352.1-207s1c1
Sequence:CCGGCAAGCTATTTCAGCAAAGGCACTCGAGTGCCTTTGCTGAAATAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025352.1-317s1c1
Sequence:CCGGCAGGAGTTTGAGCAGTCGAAACTCGAGTTTCGACTGCTCAAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025352
VALIDATED
UQCRQ MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025352.2-215s21c1
Sequence:CCGGCGCGCCTTCCCAAGCTATTTCCTCGAGGAAATAGCTTGGGAAGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025352.2-335s21c1
Sequence:CCGGCAGGAGTTTGAGCAGTCGAAACTCGAGTTTCGACTGCTCAAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025352.2-301s21c1
Sequence:CCGGTGTAGTGGTCTACCTGATCTACTCGAGTAGATCAGGTAGACCACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025352.2-188s21c1
Sequence:CCGGTCCTACAGCTTGTCGCCCTTTCTCGAGAAAGGGCGACAAGCTGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025352.1-805s1c1
Sequence:CCGGGCAGCCTTTGAAGTAAGCATTCTCGAGAATGCTTACTTCAAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025352.1-283s1c1
Sequence:CCGGTGTAGTGGTCTACCTGATCTACTCGAGTAGATCAGGTAGACCACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025352.1-170s1c1
Sequence:CCGGTCCTACAGCTTGTCGCCCTTTCTCGAGAAAGGGCGACAAGCTGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025352.1-207s1c1
Sequence:CCGGCAAGCTATTTCAGCAAAGGCACTCGAGTGCCTTTGCTGAAATAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025352.1-317s1c1
Sequence:CCGGCAGGAGTTTGAGCAGTCGAAACTCGAGTTTCGACTGCTCAAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014402
VALIDATED
UQCRQ MISSION shRNA Bacterial Glycerol Stock
ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014402.4-266s21c1
Sequence:CCGGTGAAGAGTTCGAGAGATCCAACTCGAGTTGGATCTCTCGAACTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014402.4-195s21c1
Sequence:CCGGCGCATTCGGGAGTCTTTCTTTCTCGAGAAAGAAAGACTCCCGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014402.4-222s21c1
Sequence:CCGGGTGCCGCAGTTTGTAGTGTTTCTCGAGAAACACTACAAACTGCGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014402.4-158s21c1
Sequence:CCGGGCACGTCTTCACTAAAGGAATCTCGAGATTCCTTTAGTGAAGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014402.4-114s21c1
Sequence:CCGGGTGATCAGCTACAGCTTGTCACTCGAGTGACAAGCTGTAGCTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014402.2-120s1c1
Sequence:CCGGGCACGTCTTCACTAAAGGAATCTCGAGATTCCTTTAGTGAAGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014402.2-184s1c1
Sequence:CCGGGTGCCGCAGTTTGTAGTGTTTCTCGAGAAACACTACAAACTGCGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014402.2-228s1c1
Sequence:CCGGTGAAGAGTTCGAGAGATCCAACTCGAGTTGGATCTCTCGAACTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014402.2-76s1c1
Sequence:CCGGGTGATCAGCTACAGCTTGTCACTCGAGTGACAAGCTGTAGCTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014402.2-157s1c1
Sequence:CCGGCGCATTCGGGAGTCTTTCTTTCTCGAGAAAGAAAGACTCCCGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014402
VALIDATED
UQCRQ MISSION shRNA shRNA Plasmid DNA
ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014402.4-266s21c1
Sequence:CCGGTGAAGAGTTCGAGAGATCCAACTCGAGTTGGATCTCTCGAACTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014402.4-195s21c1
Sequence:CCGGCGCATTCGGGAGTCTTTCTTTCTCGAGAAAGAAAGACTCCCGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014402.4-222s21c1
Sequence:CCGGGTGCCGCAGTTTGTAGTGTTTCTCGAGAAACACTACAAACTGCGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014402.4-158s21c1
Sequence:CCGGGCACGTCTTCACTAAAGGAATCTCGAGATTCCTTTAGTGAAGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014402.4-114s21c1
Sequence:CCGGGTGATCAGCTACAGCTTGTCACTCGAGTGACAAGCTGTAGCTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014402.2-120s1c1
Sequence:CCGGGCACGTCTTCACTAAAGGAATCTCGAGATTCCTTTAGTGAAGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014402.2-184s1c1
Sequence:CCGGGTGCCGCAGTTTGTAGTGTTTCTCGAGAAACACTACAAACTGCGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014402.2-228s1c1
Sequence:CCGGTGAAGAGTTCGAGAGATCCAACTCGAGTTGGATCTCTCGAACTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014402.2-76s1c1
Sequence:CCGGGTGATCAGCTACAGCTTGTCACTCGAGTGACAAGCTGTAGCTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014402.2-157s1c1
Sequence:CCGGCGCATTCGGGAGTCTTTCTTTCTCGAGAAAGAAAGACTCCCGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014402
VALIDATED
UQCRQ MISSION shRNA Lentiviral Transduction Particles
ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014402.4-266s21c1
Sequence:CCGGTGAAGAGTTCGAGAGATCCAACTCGAGTTGGATCTCTCGAACTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014402.4-195s21c1
Sequence:CCGGCGCATTCGGGAGTCTTTCTTTCTCGAGAAAGAAAGACTCCCGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014402.4-222s21c1
Sequence:CCGGGTGCCGCAGTTTGTAGTGTTTCTCGAGAAACACTACAAACTGCGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014402.4-158s21c1
Sequence:CCGGGCACGTCTTCACTAAAGGAATCTCGAGATTCCTTTAGTGAAGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014402.4-114s21c1
Sequence:CCGGGTGATCAGCTACAGCTTGTCACTCGAGTGACAAGCTGTAGCTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014402.2-120s1c1
Sequence:CCGGGCACGTCTTCACTAAAGGAATCTCGAGATTCCTTTAGTGAAGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014402.2-184s1c1
Sequence:CCGGGTGCCGCAGTTTGTAGTGTTTCTCGAGAAACACTACAAACTGCGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014402.2-228s1c1
Sequence:CCGGTGAAGAGTTCGAGAGATCCAACTCGAGTTGGATCTCTCGAACTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014402.2-76s1c1
Sequence:CCGGGTGATCAGCTACAGCTTGTCACTCGAGTGACAAGCTGTAGCTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014402.2-157s1c1
Sequence:CCGGCGCATTCGGGAGTCTTTCTTTCTCGAGAAAGAAAGACTCCCGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks