EMAIL THIS PAGE TO A FRIEND

URAD

ureidoimidazoline (2-oxo-4-hydroxy-4-carboxy-5-) decarboxylase

Synonyms: PRHOXNB
Gene ID:
Mouse(231903) ureidoimidazoline (2-oxo-4-hydroxy-4-carboxy-5) decarboxylase
Rat(684055) ureidoimidazoline (2-oxo-4-hydroxy-4-carboxy-5-) decarboxylase
Zebrafish(557735) ureidoimidazoline (2-oxo-4-hydroxy-4-carboxy-5-) decarboxylase
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001105577 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105577 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105577 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105577 Rosetta Predictions human pricing
XM_001068703 Rosetta Predictions rat pricing
NM_001039678 Rosetta Predictions mouse pricing
XM_989735 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324571 predicted 242
2 SASI_Hs02_00324572 predicted 299
3 SASI_Hs02_00324573 predicted 253
4 SASI_Hs02_00324574 predicted 238
5 SASI_Hs02_00324575 predicted 245
6 SASI_Hs02_00324576 predicted 228
7 SASI_Hs02_00324577 predicted 236
8 SASI_Hs02_00324578 predicted 262
9 SASI_Hs02_00324579 predicted 91
10 SASI_Hs02_00324580 predicted 95
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325539 predicted 570
2 SASI_Rn02_00325540 predicted 560
3 SASI_Rn02_00325541 predicted 553
4 SASI_Rn02_00325542 predicted 574
5 SASI_Rn02_00325543 predicted 585
6 SASI_Rn02_00325544 predicted 199
7 SASI_Rn02_00325545 predicted 562
8 SASI_Rn02_00325546 predicted 532
9 SASI_Rn02_00325547 predicted 470
10 SASI_Rn02_00325548 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120917 predicted 205
2 SASI_Mm01_00120918 predicted 427
3 SASI_Mm01_00120919 predicted 235
4 SASI_Mm01_00120920 predicted 318
5 SASI_Mm01_00120921 predicted 413
6 SASI_Mm01_00120922 predicted 342
7 SASI_Mm01_00120923 predicted 343
8 SASI_Mm01_00120924 predicted 402
9 SASI_Mm01_00120925 predicted 342
10 SASI_Mm01_00120926 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989735 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272888 predicted 639
2 SASI_Mm01_00272889 predicted 859
3 SASI_Mm01_00272890 predicted 673
4 SASI_Mm01_00272891 predicted 749
5 SASI_Mm01_00272892 predicted 854
6 SASI_Mm01_00272893 predicted 774
7 SASI_Mm01_00272894 predicted 784
8 SASI_Mm01_00272895 predicted 841
9 SASI_Mm01_00272896 predicted 776
10 SASI_Mm01_00272897 predicted 769
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039678
URAD MISSION shRNA Bacterial Glycerol Stock
ureidoimidazoline (2-oxo-4-hydroxy-4-carboxy-5-) decarboxylase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039678.1-54s21c1
Sequence:CCGGGGATGTGTTTGGGAACATTGTCTCGAGACAATGTTCCCAAACACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039678.1-125s21c1
Sequence:CCGGCTGGCTTGGAAGACTTAGAAACTCGAGTTTCTAAGTCTTCCAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039678.1-279s21c1
Sequence:CCGGAGCAGGTCTCACTAGCCTAGACTCGAGTCTAGGCTAGTGAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039678.1-163s21c1
Sequence:CCGGATTGATGCTCTCCCGAGATCACTCGAGTGATCTCGGGAGAGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039678.1-351s21c1
Sequence:CCGGCTTCGGCTTTCCGTTCGTTCTCTCGAGAGAACGAACGGAAAGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039678
URAD MISSION shRNA shRNA Plasmid DNA
ureidoimidazoline (2-oxo-4-hydroxy-4-carboxy-5-) decarboxylase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039678.1-54s21c1
Sequence:CCGGGGATGTGTTTGGGAACATTGTCTCGAGACAATGTTCCCAAACACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039678.1-125s21c1
Sequence:CCGGCTGGCTTGGAAGACTTAGAAACTCGAGTTTCTAAGTCTTCCAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039678.1-279s21c1
Sequence:CCGGAGCAGGTCTCACTAGCCTAGACTCGAGTCTAGGCTAGTGAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039678.1-163s21c1
Sequence:CCGGATTGATGCTCTCCCGAGATCACTCGAGTGATCTCGGGAGAGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039678.1-351s21c1
Sequence:CCGGCTTCGGCTTTCCGTTCGTTCTCTCGAGAGAACGAACGGAAAGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039678
URAD MISSION shRNA Lentiviral Transduction Particles
ureidoimidazoline (2-oxo-4-hydroxy-4-carboxy-5-) decarboxylase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039678.1-54s21c1
Sequence:CCGGGGATGTGTTTGGGAACATTGTCTCGAGACAATGTTCCCAAACACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039678.1-125s21c1
Sequence:CCGGCTGGCTTGGAAGACTTAGAAACTCGAGTTTCTAAGTCTTCCAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039678.1-279s21c1
Sequence:CCGGAGCAGGTCTCACTAGCCTAGACTCGAGTCTAGGCTAGTGAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039678.1-163s21c1
Sequence:CCGGATTGATGCTCTCCCGAGATCACTCGAGTGATCTCGGGAGAGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039678.1-351s21c1
Sequence:CCGGCTTCGGCTTTCCGTTCGTTCTCTCGAGAGAACGAACGGAAAGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105577
URAD MISSION shRNA Bacterial Glycerol Stock
ureidoimidazoline (2-oxo-4-hydroxy-4-carboxy-5-) decarboxylase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105577.1-103s21c1
Sequence:CCGGCAGCGGCCATTCTCTGATTTGCTCGAGCAAATCAGAGAATGGCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105577.1-65s21c1
Sequence:CCGGCTGAGAGATGTCCTCTGATTGCTCGAGCAATCAGAGGACATCTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105577.1-42s21c1
Sequence:CCGGCGTGGATGTGTTTGGGAATGCCTCGAGGCATTCCCAAACACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105577.1-78s21c1
Sequence:CCGGTCTGATTGCAGCTGCTGTTTGCTCGAGCAAACAGCAGCTGCAATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105577.1-114s21c1
Sequence:CCGGCTCTGATTTGGAAGATTTAGACTCGAGTCTAAATCTTCCAAATCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105577
URAD MISSION shRNA shRNA Plasmid DNA
ureidoimidazoline (2-oxo-4-hydroxy-4-carboxy-5-) decarboxylase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105577.1-103s21c1
Sequence:CCGGCAGCGGCCATTCTCTGATTTGCTCGAGCAAATCAGAGAATGGCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105577.1-65s21c1
Sequence:CCGGCTGAGAGATGTCCTCTGATTGCTCGAGCAATCAGAGGACATCTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105577.1-42s21c1
Sequence:CCGGCGTGGATGTGTTTGGGAATGCCTCGAGGCATTCCCAAACACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105577.1-78s21c1
Sequence:CCGGTCTGATTGCAGCTGCTGTTTGCTCGAGCAAACAGCAGCTGCAATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105577.1-114s21c1
Sequence:CCGGCTCTGATTTGGAAGATTTAGACTCGAGTCTAAATCTTCCAAATCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105577
URAD MISSION shRNA Lentiviral Transduction Particles
ureidoimidazoline (2-oxo-4-hydroxy-4-carboxy-5-) decarboxylase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105577.1-103s21c1
Sequence:CCGGCAGCGGCCATTCTCTGATTTGCTCGAGCAAATCAGAGAATGGCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105577.1-65s21c1
Sequence:CCGGCTGAGAGATGTCCTCTGATTGCTCGAGCAATCAGAGGACATCTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105577.1-42s21c1
Sequence:CCGGCGTGGATGTGTTTGGGAATGCCTCGAGGCATTCCCAAACACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105577.1-78s21c1
Sequence:CCGGTCTGATTGCAGCTGCTGTTTGCTCGAGCAAACAGCAGCTGCAATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105577.1-114s21c1
Sequence:CCGGCTCTGATTTGGAAGATTTAGACTCGAGTCTAAATCTTCCAAATCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks