EMAIL THIS PAGE TO A FRIEND

URB1

URB1 ribosome biogenesis 1 homolog (S. cerevisiae)

Synonyms: C21orf108 NPA1
UniProtKB ID: O60287, D3DSE5, Q96NX1, Q9NYQ1
Gene ID:
Mouse(207932) URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Rat(304104) URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Zebrafish(337857) URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Horse(100063896) URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
domestic cat(101093539) URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
chicken(427975) URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
dog(487735) URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
cow(530483) URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
sheep(101113560) URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
domestic guinea pig(100717452) URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Domestic Rabbit(100346733) URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
naked mole-rat(101716456) URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029497 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029497 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029497 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014825 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001073237 Rosetta Predictions rat pricing
XM_221669 Rosetta Predictions rat pricing
XM_489612 Rosetta Predictions mouse pricing
XM_904396 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342016 predicted 5475
2 SASI_Rn02_00342017 predicted 815
3 SASI_Rn02_00342018 predicted 2804
4 SASI_Rn02_00342019 predicted 800
5 SASI_Rn02_00342020 predicted 2982
6 SASI_Rn02_00342021 predicted 1647
7 SASI_Rn02_00342022 predicted 3571
8 SASI_Rn02_00342023 predicted 5723
9 SASI_Rn02_00342024 predicted 3322
10 SASI_Rn02_00342025 predicted 3308
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221669 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380281 predicted 5473
2 SASI_Rn02_00380282 predicted 813
3 SASI_Rn02_00380283 predicted 2808
4 SASI_Rn02_00380284 predicted 803
5 SASI_Rn02_00380285 predicted 2981
6 SASI_Rn02_00380286 predicted 1656
7 SASI_Rn02_00380287 predicted 3579
8 SASI_Rn02_00380288 predicted 5724
9 SASI_Rn02_00380289 predicted 3315
10 SASI_Rn02_00380290 predicted 3307
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_489612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243797 predicted 3544
2 SASI_Mm01_00243798 predicted 2603
3 SASI_Mm01_00243800 predicted 6620
4 SASI_Mm01_00243801 predicted 3816
5 SASI_Mm01_00243802 predicted 1384
6 SASI_Mm01_00243803 predicted 1116
7 SASI_Mm01_00243804 predicted 3758
8 SASI_Mm02_00427263 predicted 1821
9 SASI_Mm01_00243805 predicted 1123
10 SASI_Mm02_00427264 predicted 6158
11 SASI_Mm01_00243799 predicted 2090
12 SASI_Mm01_00243806 predicted 6648
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00430868 predicted 3526
2 SASI_Mm02_00430869 predicted 2586
3 SASI_Mm02_00430870 predicted 6602
4 SASI_Mm02_00430871 predicted 3801
5 SASI_Mm02_00430872 predicted 1355
6 SASI_Mm02_00430873 predicted 1098
7 SASI_Mm02_00430874 predicted 3739
8 SASI_Mm02_00430875 predicted 1803
9 SASI_Mm02_00430876 predicted 1103
10 SASI_Mm02_00430877 predicted 6137
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029497
VALIDATED
URB1 MISSION shRNA Bacterial Glycerol Stock
URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029497.1-7142s21c1
Sequence:CCGGTTGGTCATGGATTGGTATTAACTCGAGTTAATACCAATCCATGACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029497.1-371s21c1
Sequence:CCGGCAAGCTTTCGAGGCCATATTACTCGAGTAATATGGCCTCGAAAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029497.1-5932s21c1
Sequence:CCGGTTATCGGGCCACCATCATAAACTCGAGTTTATGATGGTGGCCCGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029497.1-1396s21c1
Sequence:CCGGCATGTTCACTCAGGCATTAAACTCGAGTTTAATGCCTGAGTGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029497.1-1440s21c1
Sequence:CCGGACTCAGCATTATCCCTTATTTCTCGAGAAATAAGGGATAATGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029497
VALIDATED
URB1 MISSION shRNA shRNA Plasmid DNA
URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029497.1-7142s21c1
Sequence:CCGGTTGGTCATGGATTGGTATTAACTCGAGTTAATACCAATCCATGACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029497.1-371s21c1
Sequence:CCGGCAAGCTTTCGAGGCCATATTACTCGAGTAATATGGCCTCGAAAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029497.1-5932s21c1
Sequence:CCGGTTATCGGGCCACCATCATAAACTCGAGTTTATGATGGTGGCCCGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029497.1-1396s21c1
Sequence:CCGGCATGTTCACTCAGGCATTAAACTCGAGTTTAATGCCTGAGTGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029497.1-1440s21c1
Sequence:CCGGACTCAGCATTATCCCTTATTTCTCGAGAAATAAGGGATAATGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029497
VALIDATED
URB1 MISSION shRNA Lentiviral Transduction Particles
URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029497.1-7142s21c1
Sequence:CCGGTTGGTCATGGATTGGTATTAACTCGAGTTAATACCAATCCATGACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029497.1-371s21c1
Sequence:CCGGCAAGCTTTCGAGGCCATATTACTCGAGTAATATGGCCTCGAAAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029497.1-5932s21c1
Sequence:CCGGTTATCGGGCCACCATCATAAACTCGAGTTTATGATGGTGGCCCGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029497.1-1396s21c1
Sequence:CCGGCATGTTCACTCAGGCATTAAACTCGAGTTTAATGCCTGAGTGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029497.1-1440s21c1
Sequence:CCGGACTCAGCATTATCCCTTATTTCTCGAGAAATAAGGGATAATGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014825
VALIDATED
URB1 MISSION shRNA Bacterial Glycerol Stock
URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014825.2-289s21c1
Sequence:CCGGGATGTTGTGGAAGGGTATATACTCGAGTATATACCCTTCCACAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014825.2-1451s21c1
Sequence:CCGGACACAGCCTTATCCCTTATTTCTCGAGAAATAAGGGATAAGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014825.2-5980s21c1
Sequence:CCGGATGAACAGATTCACCGTAAATCTCGAGATTTACGGTGAATCTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014825.2-1249s21c1
Sequence:CCGGGCGAAGTCTACTTGGTTAAATCTCGAGATTTAACCAAGTAGACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014825.2-4320s21c1
Sequence:CCGGGGAAATGCTGCTTAGATTAAACTCGAGTTTAATCTAAGCAGCATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014825
VALIDATED
URB1 MISSION shRNA shRNA Plasmid DNA
URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014825.2-289s21c1
Sequence:CCGGGATGTTGTGGAAGGGTATATACTCGAGTATATACCCTTCCACAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014825.2-1451s21c1
Sequence:CCGGACACAGCCTTATCCCTTATTTCTCGAGAAATAAGGGATAAGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014825.2-5980s21c1
Sequence:CCGGATGAACAGATTCACCGTAAATCTCGAGATTTACGGTGAATCTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014825.2-1249s21c1
Sequence:CCGGGCGAAGTCTACTTGGTTAAATCTCGAGATTTAACCAAGTAGACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014825.2-4320s21c1
Sequence:CCGGGGAAATGCTGCTTAGATTAAACTCGAGTTTAATCTAAGCAGCATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014825
VALIDATED
URB1 MISSION shRNA Lentiviral Transduction Particles
URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014825.2-289s21c1
Sequence:CCGGGATGTTGTGGAAGGGTATATACTCGAGTATATACCCTTCCACAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014825.2-1451s21c1
Sequence:CCGGACACAGCCTTATCCCTTATTTCTCGAGAAATAAGGGATAAGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014825.2-5980s21c1
Sequence:CCGGATGAACAGATTCACCGTAAATCTCGAGATTTACGGTGAATCTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014825.2-1249s21c1
Sequence:CCGGGCGAAGTCTACTTGGTTAAATCTCGAGATTTAACCAAGTAGACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014825.2-4320s21c1
Sequence:CCGGGGAAATGCTGCTTAGATTAAACTCGAGTTTAATCTAAGCAGCATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks