EMAIL THIS PAGE TO A FRIEND

URB2

URB2 ribosome biogenesis 2 homolog (S. cerevisiae)

Synonyms: KIAA0133 NET10 NPA2
UniProtKB ID: Q14146, Q5VYC9
Gene ID:
Mouse(382038) URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Rat(292087) URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
naked mole-rat(101719276) URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Domestic Rabbit(100338510) URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
domestic guinea pig(100723557) URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
cow(514623) URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
sheep(101108361) URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Zebrafish(323901) URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
chicken(421539) URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
dog(479207) URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Horse(100065914) URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
domestic cat(101094956) URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014777 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014777 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014777 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001029876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014777 Rosetta Predictions human pricing
XM_001053807 Rosetta Predictions rat pricing
XM_226578 Rosetta Predictions rat pricing
NM_001029876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230668 predicted 1252
2 SASI_Hs01_00230669 predicted 1444
3 SASI_Hs02_00346271 predicted 984
4 SASI_Hs01_00230670 predicted 4691
5 SASI_Hs01_00230671 predicted 850
6 SASI_Hs01_00230672 predicted 3123
7 SASI_Hs02_00346272 predicted 4796
8 SASI_Hs02_00346273 predicted 403
9 SASI_Hs01_00230674 predicted 3801
10 SASI_Hs01_00230675 predicted 3018
11 SASI_Hs01_00230667 predicted 2868
12 SASI_Hs01_00230673 predicted 593
13 SASI_Hs01_00230676 predicted 3057
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053807 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273642 predicted 1548
2 SASI_Rn02_00273643 predicted 3935
3 SASI_Rn02_00273644 predicted 3723
4 SASI_Rn02_00273645 predicted 1527
5 SASI_Rn02_00273646 predicted 2195
6 SASI_Rn02_00273647 predicted 2472
7 SASI_Rn02_00273648 predicted 3453
8 SASI_Rn02_00273649 predicted 2273
9 SASI_Rn02_00273650 predicted 498
10 SASI_Rn02_00273651 predicted 2060
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383695 predicted 3830
2 SASI_Rn02_00383696 predicted 1549
3 SASI_Rn02_00383697 predicted 4032
4 SASI_Rn02_00383698 predicted 3936
5 SASI_Rn02_00383699 predicted 3726
6 SASI_Rn02_00383700 predicted 1526
7 SASI_Rn02_00383701 predicted 1582
8 SASI_Rn02_00383702 predicted 3451
9 SASI_Rn02_00383703 predicted 502
10 SASI_Rn02_00383704 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288045 predicted 3528
2 SASI_Mm01_00121109 predicted 2726
3 SASI_Mm01_00121110 predicted 3731
4 SASI_Mm01_00121111 predicted 2250
5 SASI_Mm02_00288046 predicted 3880
6 SASI_Mm01_00121113 predicted 699
7 SASI_Mm01_00121114 predicted 3446
8 SASI_Mm01_00121115 predicted 2274
9 SASI_Mm01_00121116 predicted 2088
10 SASI_Mm01_00121117 predicted 3409
11 SASI_Mm01_00121112 predicted 2865
12 SASI_Mm01_00121118 predicted 1547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014777
URB2 MISSION shRNA Bacterial Glycerol Stock
URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000450260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014777.2-4797s21c1
Sequence:CCGGGATGTTCTAATTCGTAGTATTCTCGAGAATACTACGAATTAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014777.1-5182s1c1
Sequence:CCGGCCTCTAAGTATGCTTTCTGAACTCGAGTTCAGAAAGCATACTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179766    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014777.1-5090s1c1
Sequence:CCGGGCGTATAATTCAGCCCTGTTTCTCGAGAAACAGGGCTGAATTATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014777.1-4620s1c1
Sequence:CCGGCGGGAATGAGAGACATCTTTACTCGAGTAAAGATGTCTCTCATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014777.1-3598s1c1
Sequence:CCGGCCAGGGTGTTTACTCTCAGATCTCGAGATCTGAGAGTAAACACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014777.1-1316s1c1
Sequence:CCGGGCTGAGCTGCTGATAAACCATCTCGAGATGGTTTATCAGCAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014777.1-1535s1c1
Sequence:CCGGCCACGGTTGTTTGAAGAGGTTCTCGAGAACCTCTTCAAACAACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014777.1-3599s1c1
Sequence:CCGGCAGGGTGTTTACTCTCAGATACTCGAGTATCTGAGAGTAAACACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014777
URB2 MISSION shRNA shRNA Plasmid DNA
URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000450260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014777.2-4797s21c1
Sequence:CCGGGATGTTCTAATTCGTAGTATTCTCGAGAATACTACGAATTAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014777.1-5182s1c1
Sequence:CCGGCCTCTAAGTATGCTTTCTGAACTCGAGTTCAGAAAGCATACTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179766    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014777.1-5090s1c1
Sequence:CCGGGCGTATAATTCAGCCCTGTTTCTCGAGAAACAGGGCTGAATTATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014777.1-4620s1c1
Sequence:CCGGCGGGAATGAGAGACATCTTTACTCGAGTAAAGATGTCTCTCATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014777.1-3598s1c1
Sequence:CCGGCCAGGGTGTTTACTCTCAGATCTCGAGATCTGAGAGTAAACACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014777.1-1316s1c1
Sequence:CCGGGCTGAGCTGCTGATAAACCATCTCGAGATGGTTTATCAGCAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014777.1-1535s1c1
Sequence:CCGGCCACGGTTGTTTGAAGAGGTTCTCGAGAACCTCTTCAAACAACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014777.1-3599s1c1
Sequence:CCGGCAGGGTGTTTACTCTCAGATACTCGAGTATCTGAGAGTAAACACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014777
URB2 MISSION shRNA Lentiviral Transduction Particles
URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000450260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014777.2-4797s21c1
Sequence:CCGGGATGTTCTAATTCGTAGTATTCTCGAGAATACTACGAATTAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014777.1-5182s1c1
Sequence:CCGGCCTCTAAGTATGCTTTCTGAACTCGAGTTCAGAAAGCATACTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179766    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014777.1-5090s1c1
Sequence:CCGGGCGTATAATTCAGCCCTGTTTCTCGAGAAACAGGGCTGAATTATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014777.1-4620s1c1
Sequence:CCGGCGGGAATGAGAGACATCTTTACTCGAGTAAAGATGTCTCTCATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014777.1-3598s1c1
Sequence:CCGGCCAGGGTGTTTACTCTCAGATCTCGAGATCTGAGAGTAAACACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014777.1-1316s1c1
Sequence:CCGGGCTGAGCTGCTGATAAACCATCTCGAGATGGTTTATCAGCAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014777.1-1535s1c1
Sequence:CCGGCCACGGTTGTTTGAAGAGGTTCTCGAGAACCTCTTCAAACAACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014777.1-3599s1c1
Sequence:CCGGCAGGGTGTTTACTCTCAGATACTCGAGTATCTGAGAGTAAACACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029876
VALIDATED
URB2 MISSION shRNA Bacterial Glycerol Stock
URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029876.1-1552s1c1
Sequence:CCGGCTAGATAAGTTCCAGTCTTTACTCGAGTAAAGACTGGAACTTATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029876.1-913s1c1
Sequence:CCGGCCCTTGTTGTTTAGACTCTTTCTCGAGAAAGAGTCTAAACAACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029876.1-2061s1c1
Sequence:CCGGGCGGAGTAATTCACAATCCAACTCGAGTTGGATTGTGAATTACTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029876.1-2438s1c1
Sequence:CCGGCGTGTATCATTGCAGAATGTTCTCGAGAACATTCTGCAATGATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029876.1-5263s1c1
Sequence:CCGGGCGTAGAATTGGGTCTATAATCTCGAGATTATAGACCCAATTCTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029876.1-207s1c1
Sequence:CCGGGCTCTGGATCTATGTAGATAACTCGAGTTATCTACATAGATCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029876.1-5582s1c1
Sequence:CCGGGCCTTTATTATCGCTTGGAAACTCGAGTTTCCAAGCGATAATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029876
VALIDATED
URB2 MISSION shRNA shRNA Plasmid DNA
URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029876.1-1552s1c1
Sequence:CCGGCTAGATAAGTTCCAGTCTTTACTCGAGTAAAGACTGGAACTTATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029876.1-913s1c1
Sequence:CCGGCCCTTGTTGTTTAGACTCTTTCTCGAGAAAGAGTCTAAACAACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029876.1-2061s1c1
Sequence:CCGGGCGGAGTAATTCACAATCCAACTCGAGTTGGATTGTGAATTACTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029876.1-2438s1c1
Sequence:CCGGCGTGTATCATTGCAGAATGTTCTCGAGAACATTCTGCAATGATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029876.1-5263s1c1
Sequence:CCGGGCGTAGAATTGGGTCTATAATCTCGAGATTATAGACCCAATTCTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029876.1-207s1c1
Sequence:CCGGGCTCTGGATCTATGTAGATAACTCGAGTTATCTACATAGATCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029876.1-5582s1c1
Sequence:CCGGGCCTTTATTATCGCTTGGAAACTCGAGTTTCCAAGCGATAATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029876
VALIDATED
URB2 MISSION shRNA Lentiviral Transduction Particles
URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029876.1-1552s1c1
Sequence:CCGGCTAGATAAGTTCCAGTCTTTACTCGAGTAAAGACTGGAACTTATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029876.1-913s1c1
Sequence:CCGGCCCTTGTTGTTTAGACTCTTTCTCGAGAAAGAGTCTAAACAACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029876.1-2061s1c1
Sequence:CCGGGCGGAGTAATTCACAATCCAACTCGAGTTGGATTGTGAATTACTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029876.1-2438s1c1
Sequence:CCGGCGTGTATCATTGCAGAATGTTCTCGAGAACATTCTGCAATGATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029876.1-5263s1c1
Sequence:CCGGGCGTAGAATTGGGTCTATAATCTCGAGATTATAGACCCAATTCTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029876.1-207s1c1
Sequence:CCGGGCTCTGGATCTATGTAGATAACTCGAGTTATCTACATAGATCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029876.1-5582s1c1
Sequence:CCGGGCCTTTATTATCGCTTGGAAACTCGAGTTTCCAAGCGATAATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks