EMAIL THIS PAGE TO A FRIEND

URGCP

upregulator of cell proliferation

Synonyms: URG4
Gene ID:
Human(55665) Summary: URG4 is upregulated in the presence of hepatitis B virus (HBV)-encoded X antigen (HBxAg) and may contribute to the development of hepatocellular carcinoma by promoting hepatocellular growth and survival (Tufan et al., 2002 [PubMed 12082552]
Mouse(72046) upregulator of cell proliferation
Rat(305493) upregulator of cell proliferation
domestic cat(101097628) upregulator of cell proliferation
Horse(100064842) upregulator of cell proliferation
dog(610578) up-regulator of cell proliferation-like
cow(504226) upregulator of cell proliferation
sheep(101122140) upregulator of cell proliferation
domestic guinea pig(100717908) upregulator of cell proliferation
naked mole-rat(101696326) upregulator of cell proliferation
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017920 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178623 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178623 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178623 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077663 Rosetta Predictions human pricing
NM_001077664 Rosetta Predictions human pricing
NM_017920 Rosetta Predictions human pricing
NM_001077660 Rosetta Predictions rat pricing
NM_001077661 Rosetta Predictions mouse pricing
NM_178623 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313087 predicted 1132
2 SASI_Hs02_00313088 predicted 2493
3 SASI_Hs02_00313089 predicted 969
4 SASI_Hs02_00313090 predicted 2184
5 SASI_Hs02_00313091 predicted 2437
6 SASI_Hs02_00313092 predicted 954
7 SASI_Hs02_00313093 predicted 2512
8 SASI_Hs02_00313094 predicted 1238
9 SASI_Hs02_00313095 predicted 2428
10 SASI_Hs02_00313096 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313097 predicted 1335
2 SASI_Hs02_00313098 predicted 2686
3 SASI_Hs02_00313099 predicted 1167
4 SASI_Hs02_00313100 predicted 2377
5 SASI_Hs02_00313101 predicted 2639
6 SASI_Hs02_00313102 predicted 1152
7 SASI_Hs02_00313103 predicted 2704
8 SASI_Hs02_00313104 predicted 1425
9 SASI_Hs02_00313105 predicted 2629
10 SASI_Hs02_00313106 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350909 predicted 1110
2 SASI_Hs02_00350910 predicted 2466
3 SASI_Hs02_00350911 predicted 940
4 SASI_Hs01_00046661 predicted 2159
5 SASI_Hs01_00046662 predicted 2415
6 SASI_Hs01_00046663 predicted 932
7 SASI_Hs01_00046664 predicted 2482
8 SASI_Hs01_00046666 predicted 1209
9 SASI_Hs02_00350912 predicted 2399
10 SASI_Hs02_00350913 predicted 1061
11 SASI_Hs01_00046658 predicted 1365
12 SASI_Hs01_00046659 predicted 321
13 SASI_Hs01_00046660 predicted 466
14 SASI_Hs01_00046665 predicted 2676
15 SASI_Hs01_00046667 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207772 predicted 1393
2 SASI_Rn02_00207773 predicted 2450
3 SASI_Rn02_00207774 predicted 1670
4 SASI_Rn02_00207775 predicted 2713
5 SASI_Rn02_00207776 predicted 1124
6 SASI_Rn02_00207777 predicted 987
7 SASI_Rn02_00207778 predicted 2465
8 SASI_Rn02_00207779 predicted 1203
9 SASI_Rn02_00207780 predicted 1420
10 SASI_Rn02_00207781 predicted 2852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292842 predicted 2915
2 SASI_Mm02_00292843 predicted 3303
3 SASI_Mm02_00292844 predicted 1379
4 SASI_Mm02_00292845 predicted 2586
5 SASI_Mm02_00292846 predicted 1857
6 SASI_Mm02_00292847 predicted 2537
7 SASI_Mm02_00292848 predicted 1481
8 SASI_Mm02_00292849 predicted 1870
9 SASI_Mm02_00292850 predicted 1695
10 SASI_Mm02_00292851 predicted 1537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107036 predicted 2498
2 SASI_Mm02_00348985 predicted 2888
3 SASI_Mm01_00107037 predicted 963
4 SASI_Mm01_00107038 predicted 2171
5 SASI_Mm01_00107039 predicted 1441
6 SASI_Mm01_00107040 predicted 2129
7 SASI_Mm01_00107042 predicted 1070
8 SASI_Mm01_00107043 predicted 1452
9 SASI_Mm01_00107044 predicted 1279
10 SASI_Mm01_00107045 predicted 1119
11 SASI_Mm01_00107041 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017920
VALIDATED
URGCP MISSION shRNA Bacterial Glycerol Stock
upregulator of cell proliferation
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017920.2-3401s1c1
Sequence:CCGGGCGCGTTGTAACTCATGTGTTCTCGAGAACACATGAGTTACAACGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017920.2-1165s1c1
Sequence:CCGGGCGCAACACAAACCTGAGATTCTCGAGAATCTCAGGTTTGTGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017920.2-645s1c1
Sequence:CCGGCGGAGAACCACTACCATACATCTCGAGATGTATGGTAGTGGTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017920.2-3402s1c1
Sequence:CCGGCGCGTTGTAACTCATGTGTTTCTCGAGAAACACATGAGTTACAACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017920.2-1069s1c1
Sequence:CCGGGACTGACAATATCAGTAAGAACTCGAGTTCTTACTGATATTGTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_017920.2-3282s1c1
Sequence:CCGGGCACCGTATTTATTGACTGATCTCGAGATCAGTCAATAAATACGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017920.2-140s1c1
Sequence:CCGGCGTTATGGAGATGGTACAAATCTCGAGATTTGTACCATCTCCATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017920.2-2422s1c1
Sequence:CCGGGCCCAACTACCAGTTTGTATACTCGAGTATACAAACTGGTAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017920.2-319s1c1
Sequence:CCGGCAAAGACTTGCCCTGGAATTTCTCGAGAAATTCCAGGGCAAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017920.3-515s21c1
Sequence:CCGGATGACCTTGCTGCCGACATTTCTCGAGAAATGTCGGCAGCAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017920.3-184s21c1
Sequence:CCGGCGTTATGGAGATGGTACAAATCTCGAGATTTGTACCATCTCCATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017920.3-689s21c1
Sequence:CCGGCGGAGAACCACTACCATACATCTCGAGATGTATGGTAGTGGTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017920.3-3444s21c1
Sequence:CCGGCGCGTTGTAACTCATGTGTTTCTCGAGAAACACATGAGTTACAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017920
VALIDATED
URGCP MISSION shRNA shRNA Plasmid DNA
upregulator of cell proliferation
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017920.2-3401s1c1
Sequence:CCGGGCGCGTTGTAACTCATGTGTTCTCGAGAACACATGAGTTACAACGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017920.2-1165s1c1
Sequence:CCGGGCGCAACACAAACCTGAGATTCTCGAGAATCTCAGGTTTGTGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017920.2-645s1c1
Sequence:CCGGCGGAGAACCACTACCATACATCTCGAGATGTATGGTAGTGGTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017920.2-3402s1c1
Sequence:CCGGCGCGTTGTAACTCATGTGTTTCTCGAGAAACACATGAGTTACAACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017920.2-1069s1c1
Sequence:CCGGGACTGACAATATCAGTAAGAACTCGAGTTCTTACTGATATTGTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_017920.2-3282s1c1
Sequence:CCGGGCACCGTATTTATTGACTGATCTCGAGATCAGTCAATAAATACGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017920.2-140s1c1
Sequence:CCGGCGTTATGGAGATGGTACAAATCTCGAGATTTGTACCATCTCCATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017920.2-2422s1c1
Sequence:CCGGGCCCAACTACCAGTTTGTATACTCGAGTATACAAACTGGTAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017920.2-319s1c1
Sequence:CCGGCAAAGACTTGCCCTGGAATTTCTCGAGAAATTCCAGGGCAAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017920.3-515s21c1
Sequence:CCGGATGACCTTGCTGCCGACATTTCTCGAGAAATGTCGGCAGCAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017920.3-184s21c1
Sequence:CCGGCGTTATGGAGATGGTACAAATCTCGAGATTTGTACCATCTCCATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017920.3-689s21c1
Sequence:CCGGCGGAGAACCACTACCATACATCTCGAGATGTATGGTAGTGGTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017920.3-3444s21c1
Sequence:CCGGCGCGTTGTAACTCATGTGTTTCTCGAGAAACACATGAGTTACAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017920
VALIDATED
URGCP MISSION shRNA Lentiviral Transduction Particles
upregulator of cell proliferation
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017920.2-3401s1c1
Sequence:CCGGGCGCGTTGTAACTCATGTGTTCTCGAGAACACATGAGTTACAACGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017920.2-1165s1c1
Sequence:CCGGGCGCAACACAAACCTGAGATTCTCGAGAATCTCAGGTTTGTGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017920.2-645s1c1
Sequence:CCGGCGGAGAACCACTACCATACATCTCGAGATGTATGGTAGTGGTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017920.2-3402s1c1
Sequence:CCGGCGCGTTGTAACTCATGTGTTTCTCGAGAAACACATGAGTTACAACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017920.2-1069s1c1
Sequence:CCGGGACTGACAATATCAGTAAGAACTCGAGTTCTTACTGATATTGTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_017920.2-3282s1c1
Sequence:CCGGGCACCGTATTTATTGACTGATCTCGAGATCAGTCAATAAATACGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017920.2-140s1c1
Sequence:CCGGCGTTATGGAGATGGTACAAATCTCGAGATTTGTACCATCTCCATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017920.2-2422s1c1
Sequence:CCGGGCCCAACTACCAGTTTGTATACTCGAGTATACAAACTGGTAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017920.2-319s1c1
Sequence:CCGGCAAAGACTTGCCCTGGAATTTCTCGAGAAATTCCAGGGCAAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017920.3-515s21c1
Sequence:CCGGATGACCTTGCTGCCGACATTTCTCGAGAAATGTCGGCAGCAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017920.3-184s21c1
Sequence:CCGGCGTTATGGAGATGGTACAAATCTCGAGATTTGTACCATCTCCATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017920.3-689s21c1
Sequence:CCGGCGGAGAACCACTACCATACATCTCGAGATGTATGGTAGTGGTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017920.3-3444s21c1
Sequence:CCGGCGCGTTGTAACTCATGTGTTTCTCGAGAAACACATGAGTTACAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178623
VALIDATED
URGCP MISSION shRNA Bacterial Glycerol Stock
upregulator of cell proliferation
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178623.2-127s1c1
Sequence:CCGGCAGCCAAACATCTGTGGCAATCTCGAGATTGCCACAGATGTTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178623.2-2408s1c1
Sequence:CCGGGCTGAAACAAAGGACATCCCACTCGAGTGGGATGTCCTTTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178623.2-1418s1c1
Sequence:CCGGCTCAGAGTTGATGAGGACTTTCTCGAGAAAGTCCTCATCAACTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178623.2-149s1c1
Sequence:CCGGGCAGATTTGGAATGGAGAGAACTCGAGTTCTCTCCATTCCAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178623.2-3575s1c1
Sequence:CCGGGCCTTCATTGTCCTCATGCTTCTCGAGAAGCATGAGGACAATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178623.2-1079s1c1
Sequence:CCGGCAGTTCAAGCTCTTGACAGAACTCGAGTTCTGTCAAGAGCTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192747    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178623.2-2475s1c1
Sequence:CCGGGCCCAACTATCAGTTTGTGTACTCGAGTACACAAACTGATAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178623.3-3312s21c1
Sequence:CCGGTGCGCTCATGTACGGTGTATGCTCGAGCATACACCGTACATGAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178623.3-220s1c1
Sequence:CCGGCATTATGGAGATGGTACAAACCTCGAGGTTTGTACCATCTCCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178623.3-1070s21c1
Sequence:CCGGTGAACTTGAGAGGTGACATTGCTCGAGCAATGTCACCTCTCAAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178623
VALIDATED
URGCP MISSION shRNA shRNA Plasmid DNA
upregulator of cell proliferation
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178623.2-127s1c1
Sequence:CCGGCAGCCAAACATCTGTGGCAATCTCGAGATTGCCACAGATGTTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178623.2-2408s1c1
Sequence:CCGGGCTGAAACAAAGGACATCCCACTCGAGTGGGATGTCCTTTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178623.2-1418s1c1
Sequence:CCGGCTCAGAGTTGATGAGGACTTTCTCGAGAAAGTCCTCATCAACTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178623.2-149s1c1
Sequence:CCGGGCAGATTTGGAATGGAGAGAACTCGAGTTCTCTCCATTCCAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178623.2-3575s1c1
Sequence:CCGGGCCTTCATTGTCCTCATGCTTCTCGAGAAGCATGAGGACAATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178623.2-1079s1c1
Sequence:CCGGCAGTTCAAGCTCTTGACAGAACTCGAGTTCTGTCAAGAGCTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192747    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178623.2-2475s1c1
Sequence:CCGGGCCCAACTATCAGTTTGTGTACTCGAGTACACAAACTGATAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178623.3-3312s21c1
Sequence:CCGGTGCGCTCATGTACGGTGTATGCTCGAGCATACACCGTACATGAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178623.3-220s1c1
Sequence:CCGGCATTATGGAGATGGTACAAACCTCGAGGTTTGTACCATCTCCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178623.3-1070s21c1
Sequence:CCGGTGAACTTGAGAGGTGACATTGCTCGAGCAATGTCACCTCTCAAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178623
VALIDATED
URGCP MISSION shRNA Lentiviral Transduction Particles
upregulator of cell proliferation
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178623.2-127s1c1
Sequence:CCGGCAGCCAAACATCTGTGGCAATCTCGAGATTGCCACAGATGTTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178623.2-2408s1c1
Sequence:CCGGGCTGAAACAAAGGACATCCCACTCGAGTGGGATGTCCTTTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178623.2-1418s1c1
Sequence:CCGGCTCAGAGTTGATGAGGACTTTCTCGAGAAAGTCCTCATCAACTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178623.2-149s1c1
Sequence:CCGGGCAGATTTGGAATGGAGAGAACTCGAGTTCTCTCCATTCCAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178623.2-3575s1c1
Sequence:CCGGGCCTTCATTGTCCTCATGCTTCTCGAGAAGCATGAGGACAATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178623.2-1079s1c1
Sequence:CCGGCAGTTCAAGCTCTTGACAGAACTCGAGTTCTGTCAAGAGCTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192747    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178623.2-2475s1c1
Sequence:CCGGGCCCAACTATCAGTTTGTGTACTCGAGTACACAAACTGATAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178623.3-3312s21c1
Sequence:CCGGTGCGCTCATGTACGGTGTATGCTCGAGCATACACCGTACATGAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178623.3-220s1c1
Sequence:CCGGCATTATGGAGATGGTACAAACCTCGAGGTTTGTACCATCTCCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178623.3-1070s21c1
Sequence:CCGGTGAACTTGAGAGGTGACATTGCTCGAGCAATGTCACCTCTCAAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks