EMAIL THIS PAGE TO A FRIEND

URI1

URI1, prefoldin-like chaperone

Synonyms: C19orf2 NNX3 PPP1R19 RMP URI
UniProtKB ID: O94763, A8K805, H7BY42, Q8TC23, Q9UNU3
Gene ID:
Human(8725) Summary: This gene encodes member of the prefoldin family of molecular chaperones. The encoded protein functions as a scaffolding protein and plays roles in ubiquitination and transcription, in part though interactions with the RNA polymerase II subunit RPB5. This gene may play a role in multiple malignancies including ovarian cancer and hepatocellular carcinoma. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 22. [provided by RefSeq, Nov 2011]
Mouse(19777) URI1, prefoldin-like chaperone
Rat(308537) URI1, prefoldin-like chaperone
Zebrafish(560572) URI1, prefoldin-like chaperone
dog(476501) URI1, prefoldin-like chaperone
chicken(415759) chromosome 11 open reading frame, human C19orf2
naked mole-rat(101712314) URI1, prefoldin-like chaperone
domestic guinea pig(100717813) URI1, prefoldin-like chaperone
cow(515119) URI1, prefoldin-like chaperone
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011274 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011274 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011274 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003796 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003796 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003796 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003796 Rosetta Predictions human pricing
NM_134447 Rosetta Predictions human pricing
NM_001107507 Rosetta Predictions rat pricing
NM_011274 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172716 predicted 1664
2 SASI_Hs01_00172717 predicted 552
3 SASI_Hs01_00172718 predicted 686
4 SASI_Hs01_00172719 predicted 1666
5 SASI_Hs01_00172720 predicted 504
6 SASI_Hs01_00172721 predicted 1476
7 SASI_Hs01_00172722 predicted 1434
8 SASI_Hs01_00172723 predicted 444
9 SASI_Hs01_00172725 predicted 625
10 SASI_Hs02_00336315 predicted 1579
11 SASI_Hs01_00172724 predicted 1616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027086 predicted 1636
2 SASI_Hs01_00027087 predicted 521
3 SASI_Hs01_00027088 predicted 645
4 SASI_Hs01_00027089 predicted 1631
5 SASI_Hs01_00027090 predicted 472
6 SASI_Hs01_00027091 predicted 1446
7 SASI_Hs01_00027092 predicted 1400
8 SASI_Hs01_00027093 predicted 414
9 SASI_Hs01_00027095 predicted 588
10 SASI_Hs02_00363334 predicted 1551
11 SASI_Hs01_00027094 predicted 1580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107507 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229505 predicted 704
2 SASI_Rn02_00229506 predicted 536
3 SASI_Rn02_00229507 predicted 386
4 SASI_Rn02_00229508 predicted 1532
5 SASI_Rn02_00229509 predicted 706
6 SASI_Rn02_00229510 predicted 1725
7 SASI_Rn02_00229511 predicted 522
8 SASI_Rn02_00229512 predicted 1734
9 SASI_Rn02_00229513 predicted 411
10 SASI_Rn02_00229514 predicted 1659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100748 predicted 1859
2 SASI_Mm01_00100749 predicted 764
3 SASI_Mm01_00100750 predicted 745
4 SASI_Mm01_00100751 predicted 652
5 SASI_Mm01_00100752 predicted 815
6 SASI_Mm01_00100753 predicted 530
7 SASI_Mm01_00100754 predicted 836
8 SASI_Mm01_00100755 predicted 1833
9 SASI_Mm01_00100756 predicted 1778
10 SASI_Mm01_00100757 predicted 587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011274
VALIDATED
URI1 MISSION shRNA Bacterial Glycerol Stock
URI1, prefoldin-like chaperone
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011274.5-2386s21c1
Sequence:CCGGTGTCATACTGTAATCTTTAAGCTCGAGCTTAAAGATTACAGTATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011274.5-1338s21c1
Sequence:CCGGTCTCATACTGTTGAACCTAAACTCGAGTTTAGGTTCAACAGTATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011274.5-1474s21c1
Sequence:CCGGCCATCAAGAGTCCTGCTGATACTCGAGTATCAGCAGGACTCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011274.5-1512s21c1
Sequence:CCGGGATGTTGTGAATGGAGAATATCTCGAGATATTCTCCATTCACAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011274.5-2077s21c1
Sequence:CCGGTGTTCTGCTGGCTTCGTTAATCTCGAGATTAACGAAGCCAGCAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011274.5-1297s21c1
Sequence:CCGGATGCTATTTCAGCAGATAATTCTCGAGAATTATCTGCTGAAATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011274.2-2186s1c1
Sequence:CCGGCCTGGTTTAGATTGTGTATAACTCGAGTTATACACAATCTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011274.2-1514s1c1
Sequence:CCGGCCATCAGAAGTATCAGAGGAACTCGAGTTCCTCTGATACTTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011274.2-832s1c1
Sequence:CCGGTCAAGTCAATAGTCTGAACTACTCGAGTAGTTCAGACTATTGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011274.2-655s1c1
Sequence:CCGGGCTGGGTGAACTTGAAAGTAACTCGAGTTACTTTCAAGTTCACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011274.2-1134s1c1
Sequence:CCGGCCATCAAGAGTCCTGCTGATACTCGAGTATCAGCAGGACTCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011274
VALIDATED
URI1 MISSION shRNA shRNA Plasmid DNA
URI1, prefoldin-like chaperone
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011274.5-2386s21c1
Sequence:CCGGTGTCATACTGTAATCTTTAAGCTCGAGCTTAAAGATTACAGTATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011274.5-1338s21c1
Sequence:CCGGTCTCATACTGTTGAACCTAAACTCGAGTTTAGGTTCAACAGTATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011274.5-1474s21c1
Sequence:CCGGCCATCAAGAGTCCTGCTGATACTCGAGTATCAGCAGGACTCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011274.5-1512s21c1
Sequence:CCGGGATGTTGTGAATGGAGAATATCTCGAGATATTCTCCATTCACAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011274.5-2077s21c1
Sequence:CCGGTGTTCTGCTGGCTTCGTTAATCTCGAGATTAACGAAGCCAGCAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011274.5-1297s21c1
Sequence:CCGGATGCTATTTCAGCAGATAATTCTCGAGAATTATCTGCTGAAATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011274.2-2186s1c1
Sequence:CCGGCCTGGTTTAGATTGTGTATAACTCGAGTTATACACAATCTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011274.2-1514s1c1
Sequence:CCGGCCATCAGAAGTATCAGAGGAACTCGAGTTCCTCTGATACTTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011274.2-832s1c1
Sequence:CCGGTCAAGTCAATAGTCTGAACTACTCGAGTAGTTCAGACTATTGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011274.2-655s1c1
Sequence:CCGGGCTGGGTGAACTTGAAAGTAACTCGAGTTACTTTCAAGTTCACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011274.2-1134s1c1
Sequence:CCGGCCATCAAGAGTCCTGCTGATACTCGAGTATCAGCAGGACTCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011274
VALIDATED
URI1 MISSION shRNA Lentiviral Transduction Particles
URI1, prefoldin-like chaperone
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011274.5-2386s21c1
Sequence:CCGGTGTCATACTGTAATCTTTAAGCTCGAGCTTAAAGATTACAGTATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011274.5-1338s21c1
Sequence:CCGGTCTCATACTGTTGAACCTAAACTCGAGTTTAGGTTCAACAGTATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011274.5-1474s21c1
Sequence:CCGGCCATCAAGAGTCCTGCTGATACTCGAGTATCAGCAGGACTCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011274.5-1512s21c1
Sequence:CCGGGATGTTGTGAATGGAGAATATCTCGAGATATTCTCCATTCACAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011274.5-2077s21c1
Sequence:CCGGTGTTCTGCTGGCTTCGTTAATCTCGAGATTAACGAAGCCAGCAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011274.5-1297s21c1
Sequence:CCGGATGCTATTTCAGCAGATAATTCTCGAGAATTATCTGCTGAAATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011274.2-2186s1c1
Sequence:CCGGCCTGGTTTAGATTGTGTATAACTCGAGTTATACACAATCTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011274.2-1514s1c1
Sequence:CCGGCCATCAGAAGTATCAGAGGAACTCGAGTTCCTCTGATACTTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011274.2-832s1c1
Sequence:CCGGTCAAGTCAATAGTCTGAACTACTCGAGTAGTTCAGACTATTGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011274.2-655s1c1
Sequence:CCGGGCTGGGTGAACTTGAAAGTAACTCGAGTTACTTTCAAGTTCACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011274.2-1134s1c1
Sequence:CCGGCCATCAAGAGTCCTGCTGATACTCGAGTATCAGCAGGACTCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003796
VALIDATED
URI1 MISSION shRNA Bacterial Glycerol Stock
URI1, prefoldin-like chaperone
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003796.2-1552s21c1
Sequence:CCGGCGAAAGGAAGTTCTGTTGGAACTCGAGTTCCAACAGAACTTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003796.2-2141s21c1
Sequence:CCGGCCTCTGAATGTCATACTGTAACTCGAGTTACAGTATGACATTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003796.2-230s21c1
Sequence:CCGGCCTTGCCTGATAAATTGTCTTCTCGAGAAGACAATTTATCAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003796.2-1057s21c1
Sequence:CCGGCCTAAGAGGGTCCGAATAAATCTCGAGATTTATTCGGACCCTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003796.2-562s21c1
Sequence:CCGGGCTCATAAACCGCATTCCAAACTCGAGTTTGGAATGCGGTTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003796.2-2141s1c1
Sequence:CCGGCCTCTGAATGTCATACTGTAACTCGAGTTACAGTATGACATTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003796.2-1057s1c1
Sequence:CCGGCCTAAGAGGGTCCGAATAAATCTCGAGATTTATTCGGACCCTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003796.2-230s1c1
Sequence:CCGGCCTTGCCTGATAAATTGTCTTCTCGAGAAGACAATTTATCAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003796.2-562s1c1
Sequence:CCGGGCTCATAAACCGCATTCCAAACTCGAGTTTGGAATGCGGTTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003796.2-1552s1c1
Sequence:CCGGCGAAAGGAAGTTCTGTTGGAACTCGAGTTCCAACAGAACTTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003796
VALIDATED
URI1 MISSION shRNA shRNA Plasmid DNA
URI1, prefoldin-like chaperone
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003796.2-1552s21c1
Sequence:CCGGCGAAAGGAAGTTCTGTTGGAACTCGAGTTCCAACAGAACTTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003796.2-2141s21c1
Sequence:CCGGCCTCTGAATGTCATACTGTAACTCGAGTTACAGTATGACATTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003796.2-230s21c1
Sequence:CCGGCCTTGCCTGATAAATTGTCTTCTCGAGAAGACAATTTATCAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003796.2-1057s21c1
Sequence:CCGGCCTAAGAGGGTCCGAATAAATCTCGAGATTTATTCGGACCCTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003796.2-562s21c1
Sequence:CCGGGCTCATAAACCGCATTCCAAACTCGAGTTTGGAATGCGGTTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003796.2-2141s1c1
Sequence:CCGGCCTCTGAATGTCATACTGTAACTCGAGTTACAGTATGACATTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003796.2-1057s1c1
Sequence:CCGGCCTAAGAGGGTCCGAATAAATCTCGAGATTTATTCGGACCCTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003796.2-230s1c1
Sequence:CCGGCCTTGCCTGATAAATTGTCTTCTCGAGAAGACAATTTATCAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003796.2-562s1c1
Sequence:CCGGGCTCATAAACCGCATTCCAAACTCGAGTTTGGAATGCGGTTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003796.2-1552s1c1
Sequence:CCGGCGAAAGGAAGTTCTGTTGGAACTCGAGTTCCAACAGAACTTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003796
VALIDATED
URI1 MISSION shRNA Lentiviral Transduction Particles
URI1, prefoldin-like chaperone
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003796.2-1552s21c1
Sequence:CCGGCGAAAGGAAGTTCTGTTGGAACTCGAGTTCCAACAGAACTTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003796.2-2141s21c1
Sequence:CCGGCCTCTGAATGTCATACTGTAACTCGAGTTACAGTATGACATTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003796.2-230s21c1
Sequence:CCGGCCTTGCCTGATAAATTGTCTTCTCGAGAAGACAATTTATCAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003796.2-1057s21c1
Sequence:CCGGCCTAAGAGGGTCCGAATAAATCTCGAGATTTATTCGGACCCTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003796.2-562s21c1
Sequence:CCGGGCTCATAAACCGCATTCCAAACTCGAGTTTGGAATGCGGTTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003796.2-2141s1c1
Sequence:CCGGCCTCTGAATGTCATACTGTAACTCGAGTTACAGTATGACATTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003796.2-1057s1c1
Sequence:CCGGCCTAAGAGGGTCCGAATAAATCTCGAGATTTATTCGGACCCTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003796.2-230s1c1
Sequence:CCGGCCTTGCCTGATAAATTGTCTTCTCGAGAAGACAATTTATCAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003796.2-562s1c1
Sequence:CCGGGCTCATAAACCGCATTCCAAACTCGAGTTTGGAATGCGGTTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003796.2-1552s1c1
Sequence:CCGGCGAAAGGAAGTTCTGTTGGAACTCGAGTTCCAACAGAACTTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks