EMAIL THIS PAGE TO A FRIEND

URM1

ubiquitin related modifier 1

Synonyms: C9orf74
UniProtKB ID: Q9BTM9, B3KMH3, B4DV08, Q5T4B4
Gene ID:
Mouse(68205) ubiquitin related modifier 1 homolog (S. cerevisiae)
Rat(311840) ubiquitin related modifier 1
Zebrafish(558120) ubiquitin related modifier 1
chicken(417221) ubiquitin related modifier 1
dog(608549) ubiquitin related modifier 1
domestic cat(101100256) ubiquitin related modifier 1
cow(515890) ubiquitin related modifier 1
Goat(100860803) ubiquitin related modifier 1
sheep(101120152) ubiquitin related modifier 1
domestic guinea pig(100714855) ubiquitin related modifier 1
naked mole-rat(101726149) ubiquitin related modifier 1
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026615 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026615 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026615 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030914 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030914 Rosetta Predictions human pricing
XM_001076272 Rosetta Predictions rat pricing
XM_231116 Rosetta Predictions rat pricing
NM_026615 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163566 predicted 206
2 SASI_Hs01_00163567 predicted 210
3 SASI_Hs01_00163568 predicted 783
4 SASI_Hs01_00163569 predicted 572
5 SASI_Hs01_00163570 predicted 490
6 SASI_Hs02_00358454 predicted 419
7 SASI_Hs01_00163571 predicted 653
8 SASI_Hs01_00163564 predicted 209
9 SASI_Hs01_00163565 predicted 762
10 SASI_Hs01_00163572 predicted 135
11 SASI_Hs01_00163573 predicted 36
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076272 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352644 predicted 210
2 SASI_Rn02_00352645 predicted 204
3 SASI_Rn02_00352646 predicted 212
4 SASI_Rn02_00352647 predicted 626
5 SASI_Rn02_00352648 predicted 713
6 SASI_Rn02_00352649 predicted 634
7 SASI_Rn02_00352650 predicted 209
8 SASI_Rn02_00352651 predicted 654
9 SASI_Rn02_00352652 predicted 690
10 SASI_Rn02_00352653 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386664 predicted 207
2 SASI_Rn02_00386665 predicted 201
3 SASI_Rn02_00386666 predicted 210
4 SASI_Rn02_00386667 predicted 632
5 SASI_Rn02_00386668 predicted 711
6 SASI_Rn02_00386669 predicted 641
7 SASI_Rn02_00386670 predicted 208
8 SASI_Rn02_00386671 predicted 652
9 SASI_Rn02_00386672 predicted 686
10 SASI_Rn02_00386673 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101876 predicted 629
2 SASI_Mm01_00101877 predicted 633
3 SASI_Mm01_00101878 predicted 201
4 SASI_Mm01_00101879 predicted 163
5 SASI_Mm01_00101880 predicted 792
6 SASI_Mm01_00101881 predicted 733
7 SASI_Mm01_00101882 predicted 186
8 SASI_Mm01_00101883 predicted 704
9 SASI_Mm01_00101884 predicted 17
10 SASI_Mm01_00101885 predicted 377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026615
VALIDATED
URM1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin related modifier 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026615.2-133s1c1
Sequence:CCGGCCTCCTTGTCTGGATCAAGAACTCGAGTTCTTGATCCAGACAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026615.2-1418s1c1
Sequence:CCGGCCCACATTCTAAGCCAGGATTCTCGAGAATCCTGGCTTAGAATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026615.2-218s1c1
Sequence:CCGGGTGCTGATTAATGATGCCGACCTCGAGGTCGGCATCATTAATCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026615.2-122s1c1
Sequence:CCGGGATATACGGAACCTCCTTGTCCTCGAGGACAAGGAGGTTCCGTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026615.2-277s1c1
Sequence:CCGGCCAAGACAGCATCCTCTTCATCTCGAGATGAAGAGGATGCTGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026615.2-1953s1c1
Sequence:CCGGCCCAGTTAATGCTGAGCATTTCTCGAGAAATGCTCAGCATTAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026615.2-223s1c1
Sequence:CCGGGATTAATGATGCCGACTGGGACTCGAGTCCCAGTCGGCATCATTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026615.4-144s1c1
Sequence:CCGGGATCAAGAAGAATTTGCTAAACTCGAGTTTAGCAAATTCTTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026615.4-635s21c1
Sequence:CCGGACTCATGTGTCTTGGTGTATCCTCGAGGATACACCAAGACACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026615.4-222s21c1
Sequence:CCGGGATTAATGATGCCGACTGGGACTCGAGTCCCAGTCGGCATCATTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026615.4-273s21c1
Sequence:CCGGGGACCAAGACAGCATCCTCTTCTCGAGAAGAGGATGCTGTCTTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026615.4-143s21c1
Sequence:CCGGGGATCAAGAAGAATTTGCTAACTCGAGTTAGCAAATTCTTCTTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026615.4-52s21c1
Sequence:CCGGGGTGCAGAGCTCCTGTTTGATCTCGAGATCAAACAGGAGCTCTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026615
VALIDATED
URM1 MISSION shRNA shRNA Plasmid DNA
ubiquitin related modifier 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026615.2-133s1c1
Sequence:CCGGCCTCCTTGTCTGGATCAAGAACTCGAGTTCTTGATCCAGACAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026615.2-1418s1c1
Sequence:CCGGCCCACATTCTAAGCCAGGATTCTCGAGAATCCTGGCTTAGAATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026615.2-218s1c1
Sequence:CCGGGTGCTGATTAATGATGCCGACCTCGAGGTCGGCATCATTAATCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026615.2-122s1c1
Sequence:CCGGGATATACGGAACCTCCTTGTCCTCGAGGACAAGGAGGTTCCGTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026615.2-277s1c1
Sequence:CCGGCCAAGACAGCATCCTCTTCATCTCGAGATGAAGAGGATGCTGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026615.2-1953s1c1
Sequence:CCGGCCCAGTTAATGCTGAGCATTTCTCGAGAAATGCTCAGCATTAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026615.2-223s1c1
Sequence:CCGGGATTAATGATGCCGACTGGGACTCGAGTCCCAGTCGGCATCATTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026615.4-144s1c1
Sequence:CCGGGATCAAGAAGAATTTGCTAAACTCGAGTTTAGCAAATTCTTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026615.4-635s21c1
Sequence:CCGGACTCATGTGTCTTGGTGTATCCTCGAGGATACACCAAGACACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026615.4-222s21c1
Sequence:CCGGGATTAATGATGCCGACTGGGACTCGAGTCCCAGTCGGCATCATTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026615.4-273s21c1
Sequence:CCGGGGACCAAGACAGCATCCTCTTCTCGAGAAGAGGATGCTGTCTTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026615.4-143s21c1
Sequence:CCGGGGATCAAGAAGAATTTGCTAACTCGAGTTAGCAAATTCTTCTTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026615.4-52s21c1
Sequence:CCGGGGTGCAGAGCTCCTGTTTGATCTCGAGATCAAACAGGAGCTCTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026615
VALIDATED
URM1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin related modifier 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026615.2-133s1c1
Sequence:CCGGCCTCCTTGTCTGGATCAAGAACTCGAGTTCTTGATCCAGACAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026615.2-1418s1c1
Sequence:CCGGCCCACATTCTAAGCCAGGATTCTCGAGAATCCTGGCTTAGAATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026615.2-218s1c1
Sequence:CCGGGTGCTGATTAATGATGCCGACCTCGAGGTCGGCATCATTAATCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026615.2-122s1c1
Sequence:CCGGGATATACGGAACCTCCTTGTCCTCGAGGACAAGGAGGTTCCGTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026615.2-277s1c1
Sequence:CCGGCCAAGACAGCATCCTCTTCATCTCGAGATGAAGAGGATGCTGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026615.2-1953s1c1
Sequence:CCGGCCCAGTTAATGCTGAGCATTTCTCGAGAAATGCTCAGCATTAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026615.2-223s1c1
Sequence:CCGGGATTAATGATGCCGACTGGGACTCGAGTCCCAGTCGGCATCATTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026615.4-144s1c1
Sequence:CCGGGATCAAGAAGAATTTGCTAAACTCGAGTTTAGCAAATTCTTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026615.4-635s21c1
Sequence:CCGGACTCATGTGTCTTGGTGTATCCTCGAGGATACACCAAGACACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026615.4-222s21c1
Sequence:CCGGGATTAATGATGCCGACTGGGACTCGAGTCCCAGTCGGCATCATTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026615.4-273s21c1
Sequence:CCGGGGACCAAGACAGCATCCTCTTCTCGAGAAGAGGATGCTGTCTTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026615.4-143s21c1
Sequence:CCGGGGATCAAGAAGAATTTGCTAACTCGAGTTAGCAAATTCTTCTTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026615.4-52s21c1
Sequence:CCGGGGTGCAGAGCTCCTGTTTGATCTCGAGATCAAACAGGAGCTCTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030914
VALIDATED
URM1 MISSION shRNA Bacterial Glycerol Stock
ubiquitin related modifier 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030914.1-580s1c1
Sequence:CCGGCCCTCCAGTTTGTCAAGAGTTCTCGAGAACTCTTGACAAACTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030914.1-213s1c1
Sequence:CCGGCCAGGAATTCTGGTGCTGATTCTCGAGAATCAGCACCAGAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030914.1-180s1c1
Sequence:CCGGCCAGAGTTGTTCATCCAGGGACTCGAGTCCCTGGATGAACAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030914.1-144s1c1
Sequence:CCGGCTCATCTGGATCAAGAAGAATCTCGAGATTCTTCTTGATCCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030914.1-68s1c1
Sequence:CCGGGCTCCTGTTTGACGGTATTAACTCGAGTTAATACCGTCAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030914.2-622s21c2
Sequence:CCGGCCCTCCAGTTTGTCAAGAGTTCTCGAGAACTCTTGACAAACTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030914.2-186s21c1
Sequence:CCGGCTCATCTGGATCAAGAAGAATCTCGAGATTCTTCTTGATCCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030914.2-222s21c1
Sequence:CCGGCCAGAGTTGTTCATCCAGGGACTCGAGTCCCTGGATGAACAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030914.2-110s21c1
Sequence:CCGGGCTCCTGTTTGACGGTATTAACTCGAGTTAATACCGTCAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030914
VALIDATED
URM1 MISSION shRNA shRNA Plasmid DNA
ubiquitin related modifier 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030914.1-580s1c1
Sequence:CCGGCCCTCCAGTTTGTCAAGAGTTCTCGAGAACTCTTGACAAACTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030914.1-213s1c1
Sequence:CCGGCCAGGAATTCTGGTGCTGATTCTCGAGAATCAGCACCAGAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030914.1-180s1c1
Sequence:CCGGCCAGAGTTGTTCATCCAGGGACTCGAGTCCCTGGATGAACAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030914.1-144s1c1
Sequence:CCGGCTCATCTGGATCAAGAAGAATCTCGAGATTCTTCTTGATCCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030914.1-68s1c1
Sequence:CCGGGCTCCTGTTTGACGGTATTAACTCGAGTTAATACCGTCAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030914.2-622s21c2
Sequence:CCGGCCCTCCAGTTTGTCAAGAGTTCTCGAGAACTCTTGACAAACTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030914.2-186s21c1
Sequence:CCGGCTCATCTGGATCAAGAAGAATCTCGAGATTCTTCTTGATCCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030914.2-222s21c1
Sequence:CCGGCCAGAGTTGTTCATCCAGGGACTCGAGTCCCTGGATGAACAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030914.2-110s21c1
Sequence:CCGGGCTCCTGTTTGACGGTATTAACTCGAGTTAATACCGTCAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030914
VALIDATED
URM1 MISSION shRNA Lentiviral Transduction Particles
ubiquitin related modifier 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030914.1-580s1c1
Sequence:CCGGCCCTCCAGTTTGTCAAGAGTTCTCGAGAACTCTTGACAAACTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030914.1-213s1c1
Sequence:CCGGCCAGGAATTCTGGTGCTGATTCTCGAGAATCAGCACCAGAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030914.1-180s1c1
Sequence:CCGGCCAGAGTTGTTCATCCAGGGACTCGAGTCCCTGGATGAACAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030914.1-144s1c1
Sequence:CCGGCTCATCTGGATCAAGAAGAATCTCGAGATTCTTCTTGATCCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030914.1-68s1c1
Sequence:CCGGGCTCCTGTTTGACGGTATTAACTCGAGTTAATACCGTCAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030914.2-622s21c2
Sequence:CCGGCCCTCCAGTTTGTCAAGAGTTCTCGAGAACTCTTGACAAACTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030914.2-186s21c1
Sequence:CCGGCTCATCTGGATCAAGAAGAATCTCGAGATTCTTCTTGATCCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030914.2-222s21c1
Sequence:CCGGCCAGAGTTGTTCATCCAGGGACTCGAGTCCCTGGATGAACAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030914.2-110s21c1
Sequence:CCGGGCTCCTGTTTGACGGTATTAACTCGAGTTAATACCGTCAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks