EMAIL THIS PAGE TO A FRIEND

UROC1

urocanate hydratase 1

Synonyms: HMFN0320
UniProtKB ID: Q96N76, E9PE13, Q14C64, Q68CJ7
Gene ID:
Human(131669) Summary: This gene encodes an enzyme involved in histidine catabolism, metabolizing urocanic acid to formiminoglutamic acid. The gene product is known to protect the skin from ultra violet rays and is contained in human sweat. Deficiency of this gene product in the liver is an apparent cause of mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Mouse(243537) urocanase domain containing 1
Rat(685999) urocanate hydratase 1
Zebrafish(556744) urocanate hydratase 1
chicken(416035) urocanase domain containing 1
dog(476507) urocanate hydratase 1
domestic cat(101091181) urocanate hydratase 1
cow(100336419) urocanate hydratase 1
sheep(101117624) urocanate hydratase 1
cow(528246) urocanase domain containing 1
naked mole-rat(101706656) urocanate hydratase 1
domestic guinea pig(100729664) urocanate hydratase 1
Gene Class: Dehydratase
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144639 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144639 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144639 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144940 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144940 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144940 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU193151 MISSION® esiRNA esiRNA targeting mouse Uroc1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144639 Rosetta Predictions human pricing
XM_001066120 Rosetta Predictions rat pricing
NM_144940 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055512 predicted 1947
2 SASI_Hs01_00055513 predicted 1320
3 SASI_Hs01_00055514 predicted 479
4 SASI_Hs01_00055515 predicted 1345
5 SASI_Hs01_00055516 predicted 438
6 SASI_Hs01_00055517 predicted 492
7 SASI_Hs01_00055518 predicted 449
8 SASI_Hs01_00055519 predicted 231
9 SASI_Hs01_00055520 predicted 1959
10 SASI_Hs02_00364483 predicted 2011
11 SASI_Hs01_00055521 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316342 predicted 824
2 SASI_Rn02_00316343 predicted 711
3 SASI_Rn02_00316344 predicted 794
4 SASI_Rn02_00316345 predicted 424
5 SASI_Rn02_00316346 predicted 972
6 SASI_Rn02_00316347 predicted 812
7 SASI_Rn02_00316348 predicted 659
8 SASI_Rn02_00316349 predicted 261
9 SASI_Rn02_00316350 predicted 865
10 SASI_Rn02_00316351 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144940 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027783 predicted 1953
2 SASI_Mm01_00027784 predicted 333
3 SASI_Mm01_00027785 predicted 227
4 SASI_Mm01_00027786 predicted 1480
5 SASI_Mm01_00027788 predicted 980
6 SASI_Mm01_00027787 predicted 1953
7 SASI_Mm02_00340464 predicted 272
8 SASI_Mm01_00027790 predicted 1554
9 SASI_Mm01_00027791 predicted 1314
10 SASI_Mm01_00027792 predicted 1342
11 SASI_Mm01_00027789 predicted 260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144639
UROC1 MISSION shRNA Bacterial Glycerol Stock
urocanate hydratase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144639.2-1250s21c1
Sequence:CCGGTCTTCTGGGACTACGGCAATGCTCGAGCATTGCCGTAGTCCCAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144639.2-1718s21c1
Sequence:CCGGTTAGGGAGACCTCCAACATTTCTCGAGAAATGTTGGAGGTCTCCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144639.1-334s1c1
Sequence:CCGGCCGCCATCATGCACATGATTACTCGAGTAATCATGTGCATGATGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144639.1-2517s1c1
Sequence:CCGGGAAGGAGGATAGACCAGGAAACTCGAGTTTCCTGGTCTATCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144639.1-396s1c1
Sequence:CCGGCTGGTGACCTATGGAGGAAATCTCGAGATTTCCTCCATAGGTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144639.1-236s1c1
Sequence:CCGGGCAACTGTACGGACACATCTACTCGAGTAGATGTGTCCGTACAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144639.1-335s1c1
Sequence:CCGGCGCCATCATGCACATGATTATCTCGAGATAATCATGTGCATGATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144639.1-452s1c1
Sequence:CCGGGACCATGTTCTACTTGTCGAACTCGAGTTCGACAAGTAGAACATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144639.1-1350s1c1
Sequence:CCGGGACATATTCTCCCAGGGATTTCTCGAGAAATCCCTGGGAGAATATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144639.1-455s1c1
Sequence:CCGGCATGTTCTACTTGTCGAAGATCTCGAGATCTTCGACAAGTAGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144639
UROC1 MISSION shRNA shRNA Plasmid DNA
urocanate hydratase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144639.2-1250s21c1
Sequence:CCGGTCTTCTGGGACTACGGCAATGCTCGAGCATTGCCGTAGTCCCAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144639.2-1718s21c1
Sequence:CCGGTTAGGGAGACCTCCAACATTTCTCGAGAAATGTTGGAGGTCTCCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144639.1-334s1c1
Sequence:CCGGCCGCCATCATGCACATGATTACTCGAGTAATCATGTGCATGATGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144639.1-2517s1c1
Sequence:CCGGGAAGGAGGATAGACCAGGAAACTCGAGTTTCCTGGTCTATCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144639.1-396s1c1
Sequence:CCGGCTGGTGACCTATGGAGGAAATCTCGAGATTTCCTCCATAGGTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144639.1-236s1c1
Sequence:CCGGGCAACTGTACGGACACATCTACTCGAGTAGATGTGTCCGTACAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144639.1-335s1c1
Sequence:CCGGCGCCATCATGCACATGATTATCTCGAGATAATCATGTGCATGATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144639.1-452s1c1
Sequence:CCGGGACCATGTTCTACTTGTCGAACTCGAGTTCGACAAGTAGAACATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144639.1-1350s1c1
Sequence:CCGGGACATATTCTCCCAGGGATTTCTCGAGAAATCCCTGGGAGAATATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144639.1-455s1c1
Sequence:CCGGCATGTTCTACTTGTCGAAGATCTCGAGATCTTCGACAAGTAGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144639
UROC1 MISSION shRNA Lentiviral Transduction Particles
urocanate hydratase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144639.2-1250s21c1
Sequence:CCGGTCTTCTGGGACTACGGCAATGCTCGAGCATTGCCGTAGTCCCAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144639.2-1718s21c1
Sequence:CCGGTTAGGGAGACCTCCAACATTTCTCGAGAAATGTTGGAGGTCTCCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144639.1-334s1c1
Sequence:CCGGCCGCCATCATGCACATGATTACTCGAGTAATCATGTGCATGATGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144639.1-2517s1c1
Sequence:CCGGGAAGGAGGATAGACCAGGAAACTCGAGTTTCCTGGTCTATCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144639.1-396s1c1
Sequence:CCGGCTGGTGACCTATGGAGGAAATCTCGAGATTTCCTCCATAGGTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144639.1-236s1c1
Sequence:CCGGGCAACTGTACGGACACATCTACTCGAGTAGATGTGTCCGTACAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144639.1-335s1c1
Sequence:CCGGCGCCATCATGCACATGATTATCTCGAGATAATCATGTGCATGATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144639.1-452s1c1
Sequence:CCGGGACCATGTTCTACTTGTCGAACTCGAGTTCGACAAGTAGAACATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144639.1-1350s1c1
Sequence:CCGGGACATATTCTCCCAGGGATTTCTCGAGAAATCCCTGGGAGAATATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144639.1-455s1c1
Sequence:CCGGCATGTTCTACTTGTCGAAGATCTCGAGATCTTCGACAAGTAGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144940
UROC1 MISSION shRNA Bacterial Glycerol Stock
urocanate hydratase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144940.1-3154s1c1
Sequence:CCGGCCAATCCTTCAAGGGTGTGTTCTCGAGAACACACCCTTGAAGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144940.1-446s1c1
Sequence:CCGGCTGTCGAAGATGACTGAGGAACTCGAGTTCCTCAGTCATCTTCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144940.1-824s1c1
Sequence:CCGGGAGGTGGATAAAGCTGCACTTCTCGAGAAGTGCAGCTTTATCCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144940.1-1305s1c1
Sequence:CCGGCCTCCTATGTCCAGCACATTACTCGAGTAATGTGCTGGACATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144940.1-1457s1c1
Sequence:CCGGGCATCTGTGAAGCTACAGTATCTCGAGATACTGTAGCTTCACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144940
UROC1 MISSION shRNA shRNA Plasmid DNA
urocanate hydratase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144940.1-3154s1c1
Sequence:CCGGCCAATCCTTCAAGGGTGTGTTCTCGAGAACACACCCTTGAAGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144940.1-446s1c1
Sequence:CCGGCTGTCGAAGATGACTGAGGAACTCGAGTTCCTCAGTCATCTTCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144940.1-824s1c1
Sequence:CCGGGAGGTGGATAAAGCTGCACTTCTCGAGAAGTGCAGCTTTATCCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144940.1-1305s1c1
Sequence:CCGGCCTCCTATGTCCAGCACATTACTCGAGTAATGTGCTGGACATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144940.1-1457s1c1
Sequence:CCGGGCATCTGTGAAGCTACAGTATCTCGAGATACTGTAGCTTCACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144940
UROC1 MISSION shRNA Lentiviral Transduction Particles
urocanate hydratase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144940.1-3154s1c1
Sequence:CCGGCCAATCCTTCAAGGGTGTGTTCTCGAGAACACACCCTTGAAGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144940.1-446s1c1
Sequence:CCGGCTGTCGAAGATGACTGAGGAACTCGAGTTCCTCAGTCATCTTCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144940.1-824s1c1
Sequence:CCGGGAGGTGGATAAAGCTGCACTTCTCGAGAAGTGCAGCTTTATCCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144940.1-1305s1c1
Sequence:CCGGCCTCCTATGTCCAGCACATTACTCGAGTAATGTGCTGGACATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144940.1-1457s1c1
Sequence:CCGGGCATCTGTGAAGCTACAGTATCTCGAGATACTGTAGCTTCACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks