EMAIL THIS PAGE TO A FRIEND

UROD

uroporphyrinogen decarboxylase

Synonyms: PCT UPD
Gene ID:
Human(7389) Summary: This gene encodes an enzyme in the heme biosynthetic pathway. This enzyme is responsible for catalyzing the conversion of uroporphyrinogen to coproporphyrinogen through the removal of four carboxymethyl side chains. Mutations and deficiency in this enzyme are known to cause familial porphyria cutanea tarda and hepatoerythropoetic porphyria.[provided by RefSeq, Aug 2010]
Mouse(22275) uroporphyrinogen decarboxylase
Rat(29421) uroporphyrinogen decarboxylase
domestic guinea pig(100723867) uroporphyrinogen decarboxylase
naked mole-rat(101704932) uroporphyrinogen decarboxylase
Domestic Rabbit(100347910) uroporphyrinogen decarboxylase
cow(504914) uroporphyrinogen decarboxylase
sheep(497117) uroporphyrinogen decarboxylase
Zebrafish(30617) uroporphyrinogen decarboxylase
domestic cat(101089376) uroporphyrinogen decarboxylase
Horse(100052651) uroporphyrinogen decarboxylase
dog(475378) uroporphyrinogen decarboxylase
chicken(424590) uroporphyrinogen decarboxylase
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000374 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160311 MISSION® esiRNA esiRNA human UROD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000374 Rosetta Predictions human pricing
NM_019209 Rosetta Predictions rat pricing
NM_009478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161531 predicted 502
2 SASI_Hs01_00161532 predicted 1141
3 SASI_Hs01_00161533 predicted 707
4 SASI_Hs01_00161534 predicted 1120
5 SASI_Hs01_00161535 predicted 226
6 SASI_Hs01_00161536 predicted 876
7 SASI_Hs01_00161537 predicted 516
8 SASI_Hs01_00161539 predicted 425
9 SASI_Hs02_00302431 predicted 530
10 SASI_Hs01_00161540 predicted 662
11 SASI_Hs01_00161538 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262042 predicted 392
2 SASI_Rn02_00262043 predicted 444
3 SASI_Rn02_00262044 predicted 522
4 SASI_Rn02_00262045 predicted 613
5 SASI_Rn02_00262046 predicted 347
6 SASI_Rn02_00262047 predicted 353
7 SASI_Rn02_00262048 predicted 424
8 SASI_Rn02_00262049 predicted 946
9 SASI_Rn02_00262050 predicted 541
10 SASI_Rn02_00262051 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316210 predicted 377
2 SASI_Mm02_00316211 predicted 779
3 SASI_Mm01_00182700 predicted 710
4 SASI_Mm02_00316212 predicted 332
5 SASI_Mm02_00316213 predicted 790
6 SASI_Mm02_00316214 predicted 343
7 SASI_Mm02_00316215 predicted 425
8 SASI_Mm02_00316216 predicted 935
9 SASI_Mm01_00182701 predicted 550
10 SASI_Mm02_00316217 predicted 407
11 SASI_Mm01_00182702 predicted 681
12 SASI_Mm01_00182703 predicted 601
13 SASI_Mm01_00182704 predicted 942
14 SASI_Mm01_00182705 predicted 1106
15 SASI_Mm01_00182706 predicted 618
16 SASI_Mm01_00182707 predicted 1205
17 SASI_Mm01_00182708 predicted 635
18 SASI_Mm01_00182709 predicted 669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009478
VALIDATED
UROD MISSION shRNA Bacterial Glycerol Stock
uroporphyrinogen decarboxylase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009478.1-1206s1c1
Sequence:CCGGGCCTTGTATGCATCTGAGGAACTCGAGTTCCTCAGATGCATACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009478.1-400s1c1
Sequence:CCGGGCCGCTACTTACCAGAGTTTACTCGAGTAAACTCTGGTAAGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009478.1-811s1c1
Sequence:CCGGCCAAACGATGGCTCTACCAAACTCGAGTTTGGTAGAGCCATCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009478.1-510s1c1
Sequence:CCGGCCTCTGGATGCTGCCATAATTCTCGAGAATTATGGCAGCATCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009478.1-1272s1c1
Sequence:CCGGCAACGCTCAATTGCCAACCTACTCGAGTAGGTTGGCAATTGAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009478.3-497s21c1
Sequence:CCGGCCGTGGACCCTAATGACATACCTCGAGGTATGTCATTAGGGTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009478.3-144s21c1
Sequence:CCGGGCCGCTACTTACCAGAGTTTACTCGAGTAAACTCTGGTAAGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009478.3-360s21c1
Sequence:CCGGTAAGAGAAGAGCGGGACTTAGCTCGAGCTAAGTCCCGCTCTTCTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009478.3-254s21c1
Sequence:CCGGCCTCTGGATGCTGCCATAATTCTCGAGAATTATGGCAGCATCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009478.3-950s21c1
Sequence:CCGGGCCTTGTATGCATCTGAGGAACTCGAGTTCCTCAGATGCATACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009478
VALIDATED
UROD MISSION shRNA shRNA Plasmid DNA
uroporphyrinogen decarboxylase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009478.1-1206s1c1
Sequence:CCGGGCCTTGTATGCATCTGAGGAACTCGAGTTCCTCAGATGCATACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009478.1-400s1c1
Sequence:CCGGGCCGCTACTTACCAGAGTTTACTCGAGTAAACTCTGGTAAGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009478.1-811s1c1
Sequence:CCGGCCAAACGATGGCTCTACCAAACTCGAGTTTGGTAGAGCCATCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009478.1-510s1c1
Sequence:CCGGCCTCTGGATGCTGCCATAATTCTCGAGAATTATGGCAGCATCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009478.1-1272s1c1
Sequence:CCGGCAACGCTCAATTGCCAACCTACTCGAGTAGGTTGGCAATTGAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009478.3-497s21c1
Sequence:CCGGCCGTGGACCCTAATGACATACCTCGAGGTATGTCATTAGGGTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009478.3-144s21c1
Sequence:CCGGGCCGCTACTTACCAGAGTTTACTCGAGTAAACTCTGGTAAGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009478.3-360s21c1
Sequence:CCGGTAAGAGAAGAGCGGGACTTAGCTCGAGCTAAGTCCCGCTCTTCTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009478.3-254s21c1
Sequence:CCGGCCTCTGGATGCTGCCATAATTCTCGAGAATTATGGCAGCATCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009478.3-950s21c1
Sequence:CCGGGCCTTGTATGCATCTGAGGAACTCGAGTTCCTCAGATGCATACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009478
VALIDATED
UROD MISSION shRNA Lentiviral Transduction Particles
uroporphyrinogen decarboxylase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009478.1-1206s1c1
Sequence:CCGGGCCTTGTATGCATCTGAGGAACTCGAGTTCCTCAGATGCATACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009478.1-400s1c1
Sequence:CCGGGCCGCTACTTACCAGAGTTTACTCGAGTAAACTCTGGTAAGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009478.1-811s1c1
Sequence:CCGGCCAAACGATGGCTCTACCAAACTCGAGTTTGGTAGAGCCATCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009478.1-510s1c1
Sequence:CCGGCCTCTGGATGCTGCCATAATTCTCGAGAATTATGGCAGCATCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009478.1-1272s1c1
Sequence:CCGGCAACGCTCAATTGCCAACCTACTCGAGTAGGTTGGCAATTGAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009478.3-497s21c1
Sequence:CCGGCCGTGGACCCTAATGACATACCTCGAGGTATGTCATTAGGGTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009478.3-144s21c1
Sequence:CCGGGCCGCTACTTACCAGAGTTTACTCGAGTAAACTCTGGTAAGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009478.3-360s21c1
Sequence:CCGGTAAGAGAAGAGCGGGACTTAGCTCGAGCTAAGTCCCGCTCTTCTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009478.3-254s21c1
Sequence:CCGGCCTCTGGATGCTGCCATAATTCTCGAGAATTATGGCAGCATCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009478.3-950s21c1
Sequence:CCGGGCCTTGTATGCATCTGAGGAACTCGAGTTCCTCAGATGCATACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000374
VALIDATED
UROD MISSION shRNA Bacterial Glycerol Stock
uroporphyrinogen decarboxylase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000374.2-1146s1c1
Sequence:CCGGCCACTAACACAGATGATTGATCTCGAGATCAATCATCTGTGTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000374.2-616s1c1
Sequence:CCGGGTCCCATATCTGGTAGGACAACTCGAGTTGTCCTACCAGATATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000374.2-1084s1c1
Sequence:CCGGGCTGTGCATAAACACTCACGTCTCGAGACGTGAGTGTTTATGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000374.2-694s1c1
Sequence:CCGGCCACAGCTCTTCAACAAGTTTCTCGAGAAACTTGTTGAAGAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000374.2-137s1c1
Sequence:CCGGGCCGTTACTTACCAGAGTTTACTCGAGTAAACTCTGGTAAGTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000374
VALIDATED
UROD MISSION shRNA shRNA Plasmid DNA
uroporphyrinogen decarboxylase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000374.2-1146s1c1
Sequence:CCGGCCACTAACACAGATGATTGATCTCGAGATCAATCATCTGTGTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000374.2-616s1c1
Sequence:CCGGGTCCCATATCTGGTAGGACAACTCGAGTTGTCCTACCAGATATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000374.2-1084s1c1
Sequence:CCGGGCTGTGCATAAACACTCACGTCTCGAGACGTGAGTGTTTATGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000374.2-694s1c1
Sequence:CCGGCCACAGCTCTTCAACAAGTTTCTCGAGAAACTTGTTGAAGAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000374.2-137s1c1
Sequence:CCGGGCCGTTACTTACCAGAGTTTACTCGAGTAAACTCTGGTAAGTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000374
VALIDATED
UROD MISSION shRNA Lentiviral Transduction Particles
uroporphyrinogen decarboxylase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000374.2-1146s1c1
Sequence:CCGGCCACTAACACAGATGATTGATCTCGAGATCAATCATCTGTGTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000374.2-616s1c1
Sequence:CCGGGTCCCATATCTGGTAGGACAACTCGAGTTGTCCTACCAGATATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000374.2-1084s1c1
Sequence:CCGGGCTGTGCATAAACACTCACGTCTCGAGACGTGAGTGTTTATGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000374.2-694s1c1
Sequence:CCGGCCACAGCTCTTCAACAAGTTTCTCGAGAAACTTGTTGAAGAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000374.2-137s1c1
Sequence:CCGGGCCGTTACTTACCAGAGTTTACTCGAGTAAACTCTGGTAAGTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks