EMAIL THIS PAGE TO A FRIEND

UROS

uroporphyrinogen III synthase

Synonyms: UROIIIS
UniProtKB ID: P10746, B2RC13, D3DRF7, Q9H2T1
Gene ID:
Human(7390) Summary: The protein encoded by this gene catalyzes the fourth step of porphyrin biosynthesis in the heme biosynthetic pathway. Defects in this gene cause congenital erythropoietic porphyria (Gunther's disease). [provided by RefSeq, Jul 2008]
Mouse(22276) uroporphyrinogen III synthase
Rat(309070) uroporphyrinogen III synthase
Zebrafish(404731) uroporphyrinogen III synthase
Horse(100056401) uroporphyrinogen III synthase
domestic cat(100500740) uroporphyrinogen III synthase
dog(492116) uroporphyrinogen III synthase
chicken(426223) uroporphyrinogen III synthase
cow(613425) uroporphyrinogen III synthase
sheep(101105869) uroporphyrinogen III synthase
Domestic Rabbit(100340869) uroporphyrinogen III synthase
naked mole-rat(101721656) uroporphyrinogen III synthase
domestic guinea pig(100712610) uroporphyrinogen III synthase
Gene Class: Dehydratase
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000375 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000375 Rosetta Predictions human pricing
NM_001012068 Rosetta Predictions rat pricing
XM_574579 Rosetta Predictions rat pricing
NM_009479 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302432 predicted 903
2 SASI_Hs01_00191975 predicted 351
3 SASI_Hs01_00191976 predicted 790
4 SASI_Hs01_00191977 predicted 474
5 SASI_Hs02_00302433 predicted 882
6 SASI_Hs01_00191978 predicted 321
7 SASI_Hs01_00191979 predicted 896
8 SASI_Hs01_00191980 predicted 544
9 SASI_Hs01_00191981 predicted 540
10 SASI_Hs01_00191982 predicted 754
11 SASI_Hs01_00191974 predicted 675
12 SASI_Hs01_00191983 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200176 predicted 423
2 SASI_Rn01_00111081 predicted 622
3 SASI_Rn01_00111082 predicted 370
4 SASI_Rn01_00111083 predicted 246
5 SASI_Rn01_00111085 predicted 749
6 SASI_Rn01_00111086 predicted 396
7 SASI_Rn01_00111087 predicted 1141
8 SASI_Rn01_00111088 predicted 240
9 SASI_Rn01_00111089 predicted 1000
10 SASI_Rn02_00200177 predicted 1197
11 SASI_Rn01_00111084 predicted 254
12 SASI_Rn01_00111090 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574579 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179454 predicted 1175
2 SASI_Rn01_00179455 predicted 1188
3 SASI_Rn01_00179456 predicted 1208
4 SASI_Rn01_00179457 predicted 1238
5 SASI_Rn01_00179458 predicted 1200
6 SASI_Rn01_00179459 predicted 1184
7 SASI_Rn01_00179460 predicted 1182
8 SASI_Rn01_00179461 predicted 1196
9 SASI_Rn01_00179462 predicted 1181
10 SASI_Rn01_00179463 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134890 predicted 578
2 SASI_Mm01_00134891 predicted 850
3 SASI_Mm01_00134892 predicted 448
4 SASI_Mm01_00134893 predicted 1343
5 SASI_Mm01_00134894 predicted 471
6 SASI_Mm01_00134895 predicted 957
7 SASI_Mm01_00134896 predicted 1310
8 SASI_Mm01_00134897 predicted 970
9 SASI_Mm01_00134899 predicted 1145
10 SASI_Mm02_00316218 predicted 506
11 SASI_Mm01_00134898 predicted 612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009479
VALIDATED
UROS MISSION shRNA Bacterial Glycerol Stock
uroporphyrinogen III synthase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009479.2-403s21c1
Sequence:CCGGCAGCGGCCTGGATCCATATATCTCGAGATATATGGATCCAGGCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302796    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009479.2-1577s21c1
Sequence:CCGGCCAGGTCCTCTGAAAGAATAACTCGAGTTATTCTTTCAGAGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009479.1-524s1c2
Sequence:CCGGCCACCGCTTCTCTAGTGAATACTCGAGTATTCACTAGAGAAGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009479.2-669s21c1
Sequence:CCGGCCACCGCTTCTCTAGTGAATACTCGAGTATTCACTAGAGAAGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009479.2-1015s21c1
Sequence:CCGGCCAGATTAAGTTTATAGCCATCTCGAGATGGCTATAAACTTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009479.2-786s21c1
Sequence:CCGGTTCCGTGTGGAACTATCAAAGCTCGAGCTTTGATAGTTCCACACGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009479.1-1432s1c1
Sequence:CCGGCCAGGTCCTCTGAAAGAATAACTCGAGTTATTCTTTCAGAGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009479.1-819s1c1
Sequence:CCGGCCTTAAATACAGCCTCGAGTACTCGAGTACTCGAGGCTGTATTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009479.1-870s1c1
Sequence:CCGGCCAGATTAAGTTTATAGCCATCTCGAGATGGCTATAAACTTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009479.1-764s1c1
Sequence:CCGGGCTACTATGAAGATCAGGGTACTCGAGTACCCTGATCTTCATAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009479
VALIDATED
UROS MISSION shRNA shRNA Plasmid DNA
uroporphyrinogen III synthase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009479.2-403s21c1
Sequence:CCGGCAGCGGCCTGGATCCATATATCTCGAGATATATGGATCCAGGCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302796    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009479.2-1577s21c1
Sequence:CCGGCCAGGTCCTCTGAAAGAATAACTCGAGTTATTCTTTCAGAGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009479.1-524s1c2
Sequence:CCGGCCACCGCTTCTCTAGTGAATACTCGAGTATTCACTAGAGAAGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009479.2-669s21c1
Sequence:CCGGCCACCGCTTCTCTAGTGAATACTCGAGTATTCACTAGAGAAGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009479.2-1015s21c1
Sequence:CCGGCCAGATTAAGTTTATAGCCATCTCGAGATGGCTATAAACTTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009479.2-786s21c1
Sequence:CCGGTTCCGTGTGGAACTATCAAAGCTCGAGCTTTGATAGTTCCACACGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009479.1-1432s1c1
Sequence:CCGGCCAGGTCCTCTGAAAGAATAACTCGAGTTATTCTTTCAGAGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009479.1-819s1c1
Sequence:CCGGCCTTAAATACAGCCTCGAGTACTCGAGTACTCGAGGCTGTATTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009479.1-870s1c1
Sequence:CCGGCCAGATTAAGTTTATAGCCATCTCGAGATGGCTATAAACTTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009479.1-764s1c1
Sequence:CCGGGCTACTATGAAGATCAGGGTACTCGAGTACCCTGATCTTCATAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009479
VALIDATED
UROS MISSION shRNA Lentiviral Transduction Particles
uroporphyrinogen III synthase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009479.2-403s21c1
Sequence:CCGGCAGCGGCCTGGATCCATATATCTCGAGATATATGGATCCAGGCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302796    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009479.2-1577s21c1
Sequence:CCGGCCAGGTCCTCTGAAAGAATAACTCGAGTTATTCTTTCAGAGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009479.1-524s1c2
Sequence:CCGGCCACCGCTTCTCTAGTGAATACTCGAGTATTCACTAGAGAAGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009479.2-669s21c1
Sequence:CCGGCCACCGCTTCTCTAGTGAATACTCGAGTATTCACTAGAGAAGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009479.2-1015s21c1
Sequence:CCGGCCAGATTAAGTTTATAGCCATCTCGAGATGGCTATAAACTTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009479.2-786s21c1
Sequence:CCGGTTCCGTGTGGAACTATCAAAGCTCGAGCTTTGATAGTTCCACACGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009479.1-1432s1c1
Sequence:CCGGCCAGGTCCTCTGAAAGAATAACTCGAGTTATTCTTTCAGAGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009479.1-819s1c1
Sequence:CCGGCCTTAAATACAGCCTCGAGTACTCGAGTACTCGAGGCTGTATTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009479.1-870s1c1
Sequence:CCGGCCAGATTAAGTTTATAGCCATCTCGAGATGGCTATAAACTTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009479.1-764s1c1
Sequence:CCGGGCTACTATGAAGATCAGGGTACTCGAGTACCCTGATCTTCATAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000375
VALIDATED
UROS MISSION shRNA Bacterial Glycerol Stock
uroporphyrinogen III synthase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000375.2-917s21c1
Sequence:CCGGTCAAATTAAGTTTGCAGCCATCTCGAGATGGCTGCAAACTTAATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000375.2-891s21c1
Sequence:CCGGCAGGAGTTATCTGGTGACAATCTCGAGATTGTCACCAGATAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000375.2-315s21c1
Sequence:CCGGGATCCGTATATCAGGGAATTACTCGAGTAATTCCCTGATATACGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000375.2-549s21c1
Sequence:CCGGTCAGTGTATGTGGTTGGAAATCTCGAGATTTCCAACCACATACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000375.1-479s1c1
Sequence:CCGGTCAGTGTATGTGGTTGGAAATCTCGAGATTTCCAACCACATACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000375.1-847s1c1
Sequence:CCGGTCAAATTAAGTTTGCAGCCATCTCGAGATGGCTGCAAACTTAATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000375.1-404s1c1
Sequence:CCGGGCAGAGTTATGTTTGGAGCAACTCGAGTTGCTCCAAACATAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000375.1-821s1c1
Sequence:CCGGCAGGAGTTATCTGGTGACAATCTCGAGATTGTCACCAGATAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000375.1-245s1c1
Sequence:CCGGGATCCGTATATCAGGGAATTACTCGAGTAATTCCCTGATATACGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000375
VALIDATED
UROS MISSION shRNA shRNA Plasmid DNA
uroporphyrinogen III synthase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000375.2-917s21c1
Sequence:CCGGTCAAATTAAGTTTGCAGCCATCTCGAGATGGCTGCAAACTTAATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000375.2-891s21c1
Sequence:CCGGCAGGAGTTATCTGGTGACAATCTCGAGATTGTCACCAGATAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000375.2-315s21c1
Sequence:CCGGGATCCGTATATCAGGGAATTACTCGAGTAATTCCCTGATATACGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000375.2-549s21c1
Sequence:CCGGTCAGTGTATGTGGTTGGAAATCTCGAGATTTCCAACCACATACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000375.1-479s1c1
Sequence:CCGGTCAGTGTATGTGGTTGGAAATCTCGAGATTTCCAACCACATACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000375.1-847s1c1
Sequence:CCGGTCAAATTAAGTTTGCAGCCATCTCGAGATGGCTGCAAACTTAATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000375.1-404s1c1
Sequence:CCGGGCAGAGTTATGTTTGGAGCAACTCGAGTTGCTCCAAACATAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000375.1-821s1c1
Sequence:CCGGCAGGAGTTATCTGGTGACAATCTCGAGATTGTCACCAGATAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000375.1-245s1c1
Sequence:CCGGGATCCGTATATCAGGGAATTACTCGAGTAATTCCCTGATATACGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000375
VALIDATED
UROS MISSION shRNA Lentiviral Transduction Particles
uroporphyrinogen III synthase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000375.2-917s21c1
Sequence:CCGGTCAAATTAAGTTTGCAGCCATCTCGAGATGGCTGCAAACTTAATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000375.2-891s21c1
Sequence:CCGGCAGGAGTTATCTGGTGACAATCTCGAGATTGTCACCAGATAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000375.2-315s21c1
Sequence:CCGGGATCCGTATATCAGGGAATTACTCGAGTAATTCCCTGATATACGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000375.2-549s21c1
Sequence:CCGGTCAGTGTATGTGGTTGGAAATCTCGAGATTTCCAACCACATACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000375.1-479s1c1
Sequence:CCGGTCAGTGTATGTGGTTGGAAATCTCGAGATTTCCAACCACATACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000375.1-847s1c1
Sequence:CCGGTCAAATTAAGTTTGCAGCCATCTCGAGATGGCTGCAAACTTAATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000375.1-404s1c1
Sequence:CCGGGCAGAGTTATGTTTGGAGCAACTCGAGTTGCTCCAAACATAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000375.1-821s1c1
Sequence:CCGGCAGGAGTTATCTGGTGACAATCTCGAGATTGTCACCAGATAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000375.1-245s1c1
Sequence:CCGGGATCCGTATATCAGGGAATTACTCGAGTAATTCCCTGATATACGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks