EMAIL THIS PAGE TO A FRIEND

USB1

U6 snRNA biogenesis 1

Synonyms: C16orf57 HVSL1 Mpn1 PN hUsb1
UniProtKB ID: Q9BQ65, B4DWE3, B4DZW5, Q96FZ9, Q9H8X8
Gene ID:
Human(79650) Summary: This gene encodes a protein with several conserved domains, however, its exact function is not known. Mutations in this gene are associated with poikiloderma with neutropenia (PN), which shows phenotypic overlap with Rothmund-Thomson syndrome (RTS) caused by mutations in the RECQL4 gene. It is believed that this gene product interacts with RECQL4 protein via SMAD4 proteins, explaining the partial clinical overlap between PN and RTS. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2011]
Mouse(101985) U6 snRNA biogenesis 1
Rat(307643) U6 snRNA biogenesis 1
cow(510934) U6 snRNA biogenesis 1
sheep(101121962) U6 snRNA biogenesis 1
domestic guinea pig(100720438) U6 snRNA biogenesis 1
naked mole-rat(101718640) U6 snRNA biogenesis 1
Zebrafish(445066) U6 snRNA biogenesis 1
dog(611141) U6 snRNA biogenesis 1
domestic cat(101087629) U6 snRNA biogenesis 1
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024598 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024598 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024598 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133954 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133954 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133954 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038501 MISSION® esiRNA esiRNA human C16orf57 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024598 Rosetta Predictions human pricing
NM_001014013 Rosetta Predictions rat pricing
NM_133954 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193912 predicted 825
2 SASI_Hs01_00193913 predicted 353
3 SASI_Hs01_00193914 predicted 645
4 SASI_Hs01_00193915 predicted 543
5 SASI_Hs02_00356948 predicted 662
6 SASI_Hs01_00193916 predicted 717
7 SASI_Hs01_00193917 predicted 259
8 SASI_Hs01_00193919 predicted 423
9 SASI_Hs01_00193920 predicted 356
10 SASI_Hs01_00193921 predicted 483
11 SASI_Hs01_00193918 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066127 predicted 1148
2 SASI_Rn02_00201392 predicted 440
3 SASI_Rn01_00066128 predicted 531
4 SASI_Rn01_00066129 predicted 720
5 SASI_Rn01_00066130 predicted 1171
6 SASI_Rn01_00066131 predicted 607
7 SASI_Rn01_00066133 predicted 291
8 SASI_Rn01_00066134 predicted 305
9 SASI_Rn01_00066136 predicted 603
10 SASI_Rn02_00201393 predicted 497
11 SASI_Rn01_00066132 predicted 1183
12 SASI_Rn01_00066135 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119693 predicted 602
2 SASI_Mm02_00339064 predicted 781
3 SASI_Mm01_00119694 predicted 258
4 SASI_Mm02_00339065 predicted 792
5 SASI_Mm01_00119695 predicted 274
6 SASI_Mm01_00119696 predicted 297
7 SASI_Mm01_00119697 predicted 967
8 SASI_Mm01_00119698 predicted 900
9 SASI_Mm01_00119699 predicted 737
10 SASI_Mm01_00119700 predicted 306
11 SASI_Mm01_00119701 predicted 495
12 SASI_Mm01_00119702 predicted 1024
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024598
USB1 MISSION shRNA Bacterial Glycerol Stock
U6 snRNA biogenesis 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024598.2-260s1c1
Sequence:CCGGGCCTGAAGATGACAGCACAAACTCGAGTTTGTGCTGTCATCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024598.2-530s1c1
Sequence:CCGGCAGATTCTTCTTTACTGCCAACTCGAGTTGGCAGTAAAGAAGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024598.2-1056s1c1
Sequence:CCGGCTCTTTCTCTTCCTCTTCTTTCTCGAGAAAGAAGAGGAAGAGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024598.2-203s1c1
Sequence:CCGGGCAGAGATTTCCAGTACCTGACTCGAGTCAGGTACTGGAAATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024598.2-338s1c1
Sequence:CCGGCTATGTACCATATGAAGCCAACTCGAGTTGGCTTCATATGGTACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024598.2-551s1c1
Sequence:CCGGCCAGGTAAAGATTTACACCAACTCGAGTTGGTGTAAATCTTTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024598.2-857s1c1
Sequence:CCGGGTTCTTCTCGATGCCTTTGAACTCGAGTTCAAAGGCATCGAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024598.2-499s21c1
Sequence:CCGGAGGCTCTGAAAGCCCGTATGACTCGAGTCATACGGGCTTTCAGAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024598.2-777s21c1
Sequence:CCGGGCAATCGTGGATGGGTTTGAACTCGAGTTCAAACCCATCCACGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024598
USB1 MISSION shRNA shRNA Plasmid DNA
U6 snRNA biogenesis 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024598.2-260s1c1
Sequence:CCGGGCCTGAAGATGACAGCACAAACTCGAGTTTGTGCTGTCATCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024598.2-530s1c1
Sequence:CCGGCAGATTCTTCTTTACTGCCAACTCGAGTTGGCAGTAAAGAAGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024598.2-1056s1c1
Sequence:CCGGCTCTTTCTCTTCCTCTTCTTTCTCGAGAAAGAAGAGGAAGAGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024598.2-203s1c1
Sequence:CCGGGCAGAGATTTCCAGTACCTGACTCGAGTCAGGTACTGGAAATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024598.2-338s1c1
Sequence:CCGGCTATGTACCATATGAAGCCAACTCGAGTTGGCTTCATATGGTACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024598.2-551s1c1
Sequence:CCGGCCAGGTAAAGATTTACACCAACTCGAGTTGGTGTAAATCTTTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024598.2-857s1c1
Sequence:CCGGGTTCTTCTCGATGCCTTTGAACTCGAGTTCAAAGGCATCGAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024598.2-499s21c1
Sequence:CCGGAGGCTCTGAAAGCCCGTATGACTCGAGTCATACGGGCTTTCAGAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024598.2-777s21c1
Sequence:CCGGGCAATCGTGGATGGGTTTGAACTCGAGTTCAAACCCATCCACGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024598
USB1 MISSION shRNA Lentiviral Transduction Particles
U6 snRNA biogenesis 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024598.2-260s1c1
Sequence:CCGGGCCTGAAGATGACAGCACAAACTCGAGTTTGTGCTGTCATCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024598.2-530s1c1
Sequence:CCGGCAGATTCTTCTTTACTGCCAACTCGAGTTGGCAGTAAAGAAGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024598.2-1056s1c1
Sequence:CCGGCTCTTTCTCTTCCTCTTCTTTCTCGAGAAAGAAGAGGAAGAGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024598.2-203s1c1
Sequence:CCGGGCAGAGATTTCCAGTACCTGACTCGAGTCAGGTACTGGAAATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024598.2-338s1c1
Sequence:CCGGCTATGTACCATATGAAGCCAACTCGAGTTGGCTTCATATGGTACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024598.2-551s1c1
Sequence:CCGGCCAGGTAAAGATTTACACCAACTCGAGTTGGTGTAAATCTTTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024598.2-857s1c1
Sequence:CCGGGTTCTTCTCGATGCCTTTGAACTCGAGTTCAAAGGCATCGAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024598.2-499s21c1
Sequence:CCGGAGGCTCTGAAAGCCCGTATGACTCGAGTCATACGGGCTTTCAGAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024598.2-777s21c1
Sequence:CCGGGCAATCGTGGATGGGTTTGAACTCGAGTTCAAACCCATCCACGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133954
VALIDATED
USB1 MISSION shRNA Bacterial Glycerol Stock
U6 snRNA biogenesis 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133954.1-490s21c1
Sequence:CCGGTGCCAACAGGGTAAAGATTTACTCGAGTAAATCTTTACCCTGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133954.1-783s21c1
Sequence:CCGGGCTGCAAGTCCGGGAACAAATCTCGAGATTTGTTCCCGGACTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133954.1-1287s21c1
Sequence:CCGGCAGGGCACAGGGTGCTAATTTCTCGAGAAATTAGCACCCTGTGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133954.1-164s21c1
Sequence:CCGGCCTGACAGTGTGCTAAGTATGCTCGAGCATACTTAGCACACTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133954.1-611s21c1
Sequence:CCGGGAATTTGACCTTACTACTTTCCTCGAGGAAAGTAGTAAGGTCAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133954
VALIDATED
USB1 MISSION shRNA shRNA Plasmid DNA
U6 snRNA biogenesis 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133954.1-490s21c1
Sequence:CCGGTGCCAACAGGGTAAAGATTTACTCGAGTAAATCTTTACCCTGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133954.1-783s21c1
Sequence:CCGGGCTGCAAGTCCGGGAACAAATCTCGAGATTTGTTCCCGGACTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133954.1-1287s21c1
Sequence:CCGGCAGGGCACAGGGTGCTAATTTCTCGAGAAATTAGCACCCTGTGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133954.1-164s21c1
Sequence:CCGGCCTGACAGTGTGCTAAGTATGCTCGAGCATACTTAGCACACTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133954.1-611s21c1
Sequence:CCGGGAATTTGACCTTACTACTTTCCTCGAGGAAAGTAGTAAGGTCAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133954
VALIDATED
USB1 MISSION shRNA Lentiviral Transduction Particles
U6 snRNA biogenesis 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133954.1-490s21c1
Sequence:CCGGTGCCAACAGGGTAAAGATTTACTCGAGTAAATCTTTACCCTGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133954.1-783s21c1
Sequence:CCGGGCTGCAAGTCCGGGAACAAATCTCGAGATTTGTTCCCGGACTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133954.1-1287s21c1
Sequence:CCGGCAGGGCACAGGGTGCTAATTTCTCGAGAAATTAGCACCCTGTGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133954.1-164s21c1
Sequence:CCGGCCTGACAGTGTGCTAAGTATGCTCGAGCATACTTAGCACACTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133954.1-611s21c1
Sequence:CCGGGAATTTGACCTTACTACTTTCCTCGAGGAAAGTAGTAAGGTCAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks