EMAIL THIS PAGE TO A FRIEND

USE1

unconventional SNARE in the ER 1 homolog (S. cerevisiae)

Synonyms: P31 SLT1
UniProtKB ID: Q9NZ43, Q8NCK1, Q9BRT4
Gene ID:
Mouse(67023) unconventional SNARE in the ER 1 homolog (S. cerevisiae)
Rat(290627) unconventional SNARE in the ER 1 homolog (S. cerevisiae)
fruit fly(39051) CG14181 gene product from transcript CG14181-RA
chicken(420134) unconventional SNARE in the ER 1 homolog (S. cerevisiae)
dog(609734) unconventional SNARE in the ER 1 homolog (S. cerevisiae)
domestic cat(101095556) unconventional SNARE in the ER 1 homolog (S. cerevisiae)
Zebrafish(393294) unconventional SNARE in the ER 1 homolog (S. cerevisiae)
naked mole-rat(101722095) unconventional SNARE in the ER 1 homolog (S. cerevisiae)
domestic guinea pig(100731909) unconventional SNARE in the ER 1 homolog (S. cerevisiae)
cow(512890) unconventional SNARE in the ER 1 homolog (S. cerevisiae)
sheep(101113673) unconventional SNARE in the ER 1 homolog (S. cerevisiae)
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV39361 Anti-MDS032 antibody produced in rabbit affinity isolated antibody mouse, bovine, zebrafish, canine, human, horse, guinea pig, rat
immunohistochemistry, western blot pricing
AV34713 Anti-USE1 (AB1) antibody produced in rabbit IgG fraction of antiserum human, mouse, canine, guinea pig, horse, bovine, rat
western blot pricing
AV37352 Anti-Use1 antibody produced in rabbit affinity isolated antibody mouse
western blot pricing
SAB2102658 Anti-USE1 antibody produced in rabbit affinity isolated antibody canine, zebrafish, mouse, rat, guinea pig, horse, bovine, human
western blot pricing
HPA047562 Anti-USE1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA026851 Anti-USE1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry, western blot pricing
SAB2103086 Anti-USE1 antibody produced in rabbit affinity isolated antibody rat, mouse, zebrafish, human, guinea pig, canine, bovine, horse
western blot pricing
SAB2106410 Anti-USE1 antibody produced in rabbit affinity isolated antibody mouse
ELISA, western blot pricing
SAB1411086 Anti-USE1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025917 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025917 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025917 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018467 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029768 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029768 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029768 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137521 MISSION® esiRNA esiRNA human USE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018467 Rosetta Predictions human pricing
XM_001065114 Rosetta Predictions rat pricing
XM_214304 Rosetta Predictions rat pricing
NM_025917 Rosetta Predictions mouse pricing
NM_029768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117188 predicted 546
2 SASI_Hs01_00117190 predicted 573
3 SASI_Hs01_00117191 predicted 412
4 SASI_Hs01_00117192 predicted 376
5 SASI_Hs01_00117193 predicted 429
6 SASI_Hs01_00117194 predicted 285
7 SASI_Hs01_00117195 predicted 276
8 SASI_Hs01_00117196 predicted 417
9 SASI_Hs01_00117197 predicted 607
10 SASI_Hs02_00352033 predicted 384
11 SASI_Hs01_00117189 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065114 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312922 predicted 497
2 SASI_Rn02_00312923 predicted 220
3 SASI_Rn02_00312924 predicted 387
4 SASI_Rn02_00312925 predicted 558
5 SASI_Rn02_00312926 predicted 351
6 SASI_Rn02_00312927 predicted 255
7 SASI_Rn02_00312928 predicted 355
8 SASI_Rn02_00312929 predicted 470
9 SASI_Rn02_00312930 predicted 204
10 SASI_Rn02_00312931 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375209 predicted 497
2 SASI_Rn02_00375210 predicted 227
3 SASI_Rn02_00375211 predicted 386
4 SASI_Rn02_00375212 predicted 549
5 SASI_Rn02_00375213 predicted 356
6 SASI_Rn02_00375214 predicted 256
7 SASI_Rn02_00375215 predicted 353
8 SASI_Rn02_00375216 predicted 471
9 SASI_Rn02_00375217 predicted 199
10 SASI_Rn02_00375218 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132311 predicted 199
2 SASI_Mm01_00132312 predicted 492
3 SASI_Mm01_00132313 predicted 225
4 SASI_Mm02_00329271 predicted 393
5 SASI_Mm01_00132314 predicted 553
6 SASI_Mm01_00132315 predicted 398
7 SASI_Mm01_00132316 predicted 374
8 SASI_Mm01_00132317 predicted 346
9 SASI_Mm01_00132318 predicted 445
10 SASI_Mm01_00132319 predicted 355
11 SASI_Mm01_00132320 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030409 predicted 647
2 SASI_Mm01_00030410 predicted 535
3 SASI_Mm01_00030411 predicted 449
4 SASI_Mm01_00030412 predicted 421
5 SASI_Mm01_00030413 predicted 441
6 SASI_Mm01_00030414 predicted 592
7 SASI_Mm01_00030415 predicted 434
8 SASI_Mm01_00030416 predicted 442
9 SASI_Mm01_00030417 predicted 640
10 SASI_Mm01_00030418 predicted 437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025917
VALIDATED
USE1 MISSION shRNA Bacterial Glycerol Stock
unconventional SNARE in the ER 1 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025917.4-695s21c1
Sequence:GTACCGGTGAAGCTGGAGTCGGAGAGATCTCGAGATCTCTCCGACTCCAGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025917.4-188s21c1
Sequence:CCGGTGAAAGTTCAAGCAAGTAAACCTCGAGGTTTACTTGCTTGAACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025917.4-363s21c1
Sequence:CCGGTGCCACCAAGACTGTACATTTCTCGAGAAATGTACAGTCTTGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025917.4-233s21c1
Sequence:CCGGACTCCCGCAAAGTGGACTTTCCTCGAGGAAAGTCCACTTTGCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025917.4-651s21c1
Sequence:CCGGCCTGTCACATTCACTCAAGATCTCGAGATCTTGAGTGAATGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025917.4-621s21c1
Sequence:CCGGCCAGAGTGTCATCAAGAAGGACTCGAGTCCTTCTTGATGACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025917.4-91s21c1
Sequence:GTACCGGCTTTGTCGCTGTGAGTCGATGCTCGAGCATCGACTCACAGCGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025917
VALIDATED
USE1 MISSION shRNA shRNA Plasmid DNA
unconventional SNARE in the ER 1 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025917.4-695s21c1
Sequence:GTACCGGTGAAGCTGGAGTCGGAGAGATCTCGAGATCTCTCCGACTCCAGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025917.4-188s21c1
Sequence:CCGGTGAAAGTTCAAGCAAGTAAACCTCGAGGTTTACTTGCTTGAACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025917.4-363s21c1
Sequence:CCGGTGCCACCAAGACTGTACATTTCTCGAGAAATGTACAGTCTTGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025917.4-233s21c1
Sequence:CCGGACTCCCGCAAAGTGGACTTTCCTCGAGGAAAGTCCACTTTGCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025917.4-651s21c1
Sequence:CCGGCCTGTCACATTCACTCAAGATCTCGAGATCTTGAGTGAATGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025917.4-621s21c1
Sequence:CCGGCCAGAGTGTCATCAAGAAGGACTCGAGTCCTTCTTGATGACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025917.4-91s21c1
Sequence:GTACCGGCTTTGTCGCTGTGAGTCGATGCTCGAGCATCGACTCACAGCGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025917
VALIDATED
USE1 MISSION shRNA Lentiviral Transduction Particles
unconventional SNARE in the ER 1 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025917.4-695s21c1
Sequence:GTACCGGTGAAGCTGGAGTCGGAGAGATCTCGAGATCTCTCCGACTCCAGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025917.4-188s21c1
Sequence:CCGGTGAAAGTTCAAGCAAGTAAACCTCGAGGTTTACTTGCTTGAACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025917.4-363s21c1
Sequence:CCGGTGCCACCAAGACTGTACATTTCTCGAGAAATGTACAGTCTTGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025917.4-233s21c1
Sequence:CCGGACTCCCGCAAAGTGGACTTTCCTCGAGGAAAGTCCACTTTGCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025917.4-651s21c1
Sequence:CCGGCCTGTCACATTCACTCAAGATCTCGAGATCTTGAGTGAATGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025917.4-621s21c1
Sequence:CCGGCCAGAGTGTCATCAAGAAGGACTCGAGTCCTTCTTGATGACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025917.4-91s21c1
Sequence:GTACCGGCTTTGTCGCTGTGAGTCGATGCTCGAGCATCGACTCACAGCGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018467
VALIDATED
USE1 MISSION shRNA Bacterial Glycerol Stock
unconventional SNARE in the ER 1 homolog (S. cerevisiae)
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-551s21c1
Sequence:GTACCGGGACATCAGAACCTCCAGGAAACTCGAGTTTCCTGGAGGTTCTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-377s21c1
Sequence:GTACCGGCAAAGACGGTGCATCTGCAGTCTCGAGACTGCAGATGCACCGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-698s21c1
Sequence:GTACCGGAGAAACTGAAGACGGAGTCAGCTCGAGCTGACTCCGTCTTCAGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-240s21c1
Sequence:GTACCGGATATTCCTGGAAGGTGGATTTCTCGAGAAATCCACCTTCCAGGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-197s21c1
Sequence:GTACCGGTGAAGGTCCACGCGAGCAAACCTCGAGGTTTGCTCGCGTGGACCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-453s21c1
Sequence:GTACCGGAGAGCCTGAGATGGACGTAAGCTCGAGCTTACGTCCATCTCAGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018467.3-627s21c1
Sequence:GTACCGGCGCCCAGAGTGTCATCAAGAACTCGAGTTCTTGATGACACTCTGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-467s21c1
Sequence:GTACCGGACGTAAGGAAGAGAACTGGAGCTCGAGCTCCAGTTCTCTTCCTTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-290s21c1
Sequence:GTACCGGTGACCTCCTCCTCAGAGAAAGCTCGAGCTTTCTCTGAGGAGGAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-418s21c1
Sequence:GTACCGGGAGATGCGGAGTGAGCTACTACTCGAGTAGTAGCTCACTCCGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018467.1-604s1c1
Sequence:CCGGGAGTGTCATCAAGAAGGACAACTCGAGTTGTCCTTCTTGATGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018467.1-209s1c1
Sequence:CCGGGAATATTCCTGGAAGGTGGATCTCGAGATCCACCTTCCAGGAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_018467.1-439s1c1
Sequence:CCGGCGTAAGGAAGAGAACTGGAGTCTCGAGACTCCAGTTCTCTTCCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018467.1-668s1c1
Sequence:CCGGGAGAAACTGAAGACGGAGTCACTCGAGTGACTCCGTCTTCAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_018467.1-670s1c1
Sequence:CCGGGAAACTGAAGACGGAGTCAGACTCGAGTCTGACTCCGTCTTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_018467.2-447s1c1
Sequence:CCGGGAGATGGACGTAAGGAAGAGACTCGAGTCTCTTCCTTACGTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_018467.2-453s1c1
Sequence:CCGGGACGTAAGGAAGAGAACTGGACTCGAGTCCAGTTCTCTTCCTTACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018467.2-617s1c1
Sequence:CCGGCCAGAGTGTCATCAAGAAGGACTCGAGTCCTTCTTGATGACACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018467
VALIDATED
USE1 MISSION shRNA shRNA Plasmid DNA
unconventional SNARE in the ER 1 homolog (S. cerevisiae)
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-551s21c1
Sequence:GTACCGGGACATCAGAACCTCCAGGAAACTCGAGTTTCCTGGAGGTTCTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-377s21c1
Sequence:GTACCGGCAAAGACGGTGCATCTGCAGTCTCGAGACTGCAGATGCACCGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-698s21c1
Sequence:GTACCGGAGAAACTGAAGACGGAGTCAGCTCGAGCTGACTCCGTCTTCAGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-240s21c1
Sequence:GTACCGGATATTCCTGGAAGGTGGATTTCTCGAGAAATCCACCTTCCAGGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-197s21c1
Sequence:GTACCGGTGAAGGTCCACGCGAGCAAACCTCGAGGTTTGCTCGCGTGGACCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-453s21c1
Sequence:GTACCGGAGAGCCTGAGATGGACGTAAGCTCGAGCTTACGTCCATCTCAGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018467.3-627s21c1
Sequence:GTACCGGCGCCCAGAGTGTCATCAAGAACTCGAGTTCTTGATGACACTCTGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-467s21c1
Sequence:GTACCGGACGTAAGGAAGAGAACTGGAGCTCGAGCTCCAGTTCTCTTCCTTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-290s21c1
Sequence:GTACCGGTGACCTCCTCCTCAGAGAAAGCTCGAGCTTTCTCTGAGGAGGAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-418s21c1
Sequence:GTACCGGGAGATGCGGAGTGAGCTACTACTCGAGTAGTAGCTCACTCCGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018467.1-604s1c1
Sequence:CCGGGAGTGTCATCAAGAAGGACAACTCGAGTTGTCCTTCTTGATGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018467.1-209s1c1
Sequence:CCGGGAATATTCCTGGAAGGTGGATCTCGAGATCCACCTTCCAGGAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_018467.1-439s1c1
Sequence:CCGGCGTAAGGAAGAGAACTGGAGTCTCGAGACTCCAGTTCTCTTCCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018467.1-668s1c1
Sequence:CCGGGAGAAACTGAAGACGGAGTCACTCGAGTGACTCCGTCTTCAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_018467.1-670s1c1
Sequence:CCGGGAAACTGAAGACGGAGTCAGACTCGAGTCTGACTCCGTCTTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_018467.2-447s1c1
Sequence:CCGGGAGATGGACGTAAGGAAGAGACTCGAGTCTCTTCCTTACGTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_018467.2-453s1c1
Sequence:CCGGGACGTAAGGAAGAGAACTGGACTCGAGTCCAGTTCTCTTCCTTACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018467.2-617s1c1
Sequence:CCGGCCAGAGTGTCATCAAGAAGGACTCGAGTCCTTCTTGATGACACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018467
VALIDATED
USE1 MISSION shRNA Lentiviral Transduction Particles
unconventional SNARE in the ER 1 homolog (S. cerevisiae)
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-551s21c1
Sequence:GTACCGGGACATCAGAACCTCCAGGAAACTCGAGTTTCCTGGAGGTTCTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-377s21c1
Sequence:GTACCGGCAAAGACGGTGCATCTGCAGTCTCGAGACTGCAGATGCACCGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-698s21c1
Sequence:GTACCGGAGAAACTGAAGACGGAGTCAGCTCGAGCTGACTCCGTCTTCAGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-240s21c1
Sequence:GTACCGGATATTCCTGGAAGGTGGATTTCTCGAGAAATCCACCTTCCAGGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-197s21c1
Sequence:GTACCGGTGAAGGTCCACGCGAGCAAACCTCGAGGTTTGCTCGCGTGGACCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-453s21c1
Sequence:GTACCGGAGAGCCTGAGATGGACGTAAGCTCGAGCTTACGTCCATCTCAGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018467.3-627s21c1
Sequence:GTACCGGCGCCCAGAGTGTCATCAAGAACTCGAGTTCTTGATGACACTCTGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-467s21c1
Sequence:GTACCGGACGTAAGGAAGAGAACTGGAGCTCGAGCTCCAGTTCTCTTCCTTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-290s21c1
Sequence:GTACCGGTGACCTCCTCCTCAGAGAAAGCTCGAGCTTTCTCTGAGGAGGAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018467.3-418s21c1
Sequence:GTACCGGGAGATGCGGAGTGAGCTACTACTCGAGTAGTAGCTCACTCCGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018467.1-604s1c1
Sequence:CCGGGAGTGTCATCAAGAAGGACAACTCGAGTTGTCCTTCTTGATGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018467.1-209s1c1
Sequence:CCGGGAATATTCCTGGAAGGTGGATCTCGAGATCCACCTTCCAGGAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_018467.1-439s1c1
Sequence:CCGGCGTAAGGAAGAGAACTGGAGTCTCGAGACTCCAGTTCTCTTCCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018467.1-668s1c1
Sequence:CCGGGAGAAACTGAAGACGGAGTCACTCGAGTGACTCCGTCTTCAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_018467.1-670s1c1
Sequence:CCGGGAAACTGAAGACGGAGTCAGACTCGAGTCTGACTCCGTCTTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_018467.2-447s1c1
Sequence:CCGGGAGATGGACGTAAGGAAGAGACTCGAGTCTCTTCCTTACGTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_018467.2-453s1c1
Sequence:CCGGGACGTAAGGAAGAGAACTGGACTCGAGTCCAGTTCTCTTCCTTACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018467.2-617s1c1
Sequence:CCGGCCAGAGTGTCATCAAGAAGGACTCGAGTCCTTCTTGATGACACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029768
VALIDATED
USE1 MISSION shRNA Bacterial Glycerol Stock
unconventional SNARE in the ER 1 homolog (S. cerevisiae)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000126244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029768.2-683s1c1
Sequence:CCGGCCTGTCACATTCACTCAAGATCTCGAGATCTTGAGTGAATGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029768.2-656s1c1
Sequence:CCGGGAGTGTCATCAAGAAGGACAACTCGAGTTGTCCTTCTTGATGACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029768.2-653s1c1
Sequence:CCGGCCAGAGTGTCATCAAGAAGGACTCGAGTCCTTCTTGATGACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029768.2-452s1c1
Sequence:CCGGGCCACATGGATGTCTTTACCTCTCGAGAGGTAAAGACATCCATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029768
VALIDATED
USE1 MISSION shRNA shRNA Plasmid DNA
unconventional SNARE in the ER 1 homolog (S. cerevisiae)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000126244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029768.2-683s1c1
Sequence:CCGGCCTGTCACATTCACTCAAGATCTCGAGATCTTGAGTGAATGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029768.2-656s1c1
Sequence:CCGGGAGTGTCATCAAGAAGGACAACTCGAGTTGTCCTTCTTGATGACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029768.2-653s1c1
Sequence:CCGGCCAGAGTGTCATCAAGAAGGACTCGAGTCCTTCTTGATGACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029768.2-452s1c1
Sequence:CCGGGCCACATGGATGTCTTTACCTCTCGAGAGGTAAAGACATCCATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029768
VALIDATED
USE1 MISSION shRNA Lentiviral Transduction Particles
unconventional SNARE in the ER 1 homolog (S. cerevisiae)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000126244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029768.2-683s1c1
Sequence:CCGGCCTGTCACATTCACTCAAGATCTCGAGATCTTGAGTGAATGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029768.2-656s1c1
Sequence:CCGGGAGTGTCATCAAGAAGGACAACTCGAGTTGTCCTTCTTGATGACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029768.2-653s1c1
Sequence:CCGGCCAGAGTGTCATCAAGAAGGACTCGAGTCCTTCTTGATGACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029768.2-452s1c1
Sequence:CCGGGCCACATGGATGTCTTTACCTCTCGAGAGGTAAAGACATCCATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks