EMAIL THIS PAGE TO A FRIEND

USF1

upstream transcription factor 1

Synonyms: FCHL FCHL1 HYPLIP1 MLTF MLTFI UEF bHLHb11
UniProtKB ID: P22415, B2RBZ4, Q5SY46
Gene ID:
Human(7391) Summary: This gene encodes a member of the basic helix-loop-helix leucine zipper family, and can function as a cellular transcription factor. The encoded protein can activate transcription through pyrimidine-rich initiator (Inr) elements and E-box motifs. This gene has been linked to familial combined hyperlipidemia (FCHL). Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been defined on chromosome 21. [provided by RefSeq, Feb 2013]
Mouse(22278) upstream transcription factor 1
Rat(83586) upstream transcription factor 1
Zebrafish(393266) upstream transcription factor 1
dog(488646) upstream transcription factor 1
domestic cat(101093330) upstream transcription factor 1
chicken(425126) upstream transcription factor 1
cow(407239) upstream transcription factor 1
sheep(101122908) upstream transcription factor 1
domestic guinea pig(100733772) upstream transcription factor 1
naked mole-rat(101712666) upstream transcription factor 1
Domestic Rabbit(100009324) upstream transcription factor 1
139 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009480 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009480 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009480 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007122 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007122 Rosetta Predictions human pricing
NM_207005 Rosetta Predictions human pricing
NM_031777 Rosetta Predictions rat pricing
NM_009480 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185068 predicted 1244
2 SASI_Hs01_00185069 predicted 1453
3 SASI_Hs01_00185070 predicted 952
4 SASI_Hs02_00342996 predicted 1392
5 SASI_Hs01_00185072 predicted 900
6 SASI_Hs01_00185073 predicted 1083
7 SASI_Hs01_00185074 predicted 1014
8 SASI_Hs01_00185075 predicted 905
9 SASI_Hs01_00185076 predicted 1401
10 SASI_Hs02_00342997 predicted 1023
11 SASI_Hs01_00185071 predicted 1359
12 SASI_Hs01_00185077 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203281 predicted 1205
2 SASI_Hs01_00203282 predicted 1427
3 SASI_Hs01_00203283 predicted 921
4 SASI_Hs02_00373700 predicted 1366
5 SASI_Hs01_00203285 predicted 877
6 SASI_Hs01_00203286 predicted 1060
7 SASI_Hs01_00203287 predicted 978
8 SASI_Hs01_00203288 predicted 866
9 SASI_Hs01_00203289 predicted 1369
10 SASI_Hs02_00373701 predicted 995
11 SASI_Hs01_00203284 predicted 1327
12 SASI_Hs01_00203290 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086189 predicted 265
2 SASI_Rn01_00086190 predicted 822
3 SASI_Rn02_00265215 predicted 1166
4 SASI_Rn01_00086191 predicted 853
5 SASI_Rn01_00086192 predicted 1020
6 SASI_Rn01_00086193 predicted 1226
7 SASI_Rn01_00086194 predicted 776
8 SASI_Rn01_00086195 predicted 616
9 SASI_Rn01_00086196 predicted 351
10 SASI_Rn01_00086197 predicted 375
11 SASI_Rn01_00086188 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181576 predicted 397
2 SASI_Mm02_00316219 predicted 1372
3 SASI_Mm01_00181577 predicted 962
4 SASI_Mm01_00181578 predicted 1029
5 SASI_Mm01_00181579 predicted 990
6 SASI_Mm01_00181580 predicted 965
7 SASI_Mm01_00181582 predicted 538
8 SASI_Mm01_00181583 predicted 912
9 SASI_Mm01_00181584 predicted 1172
10 SASI_Mm02_00316220 predicted 508
11 SASI_Mm01_00181575 predicted 358
12 SASI_Mm01_00181581 predicted 654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009480
VALIDATED
USF1 MISSION shRNA Bacterial Glycerol Stock
upstream transcription factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009480.1-591s1c1
Sequence:CCGGGCTGAGACACATTATACATATCTCGAGATATGTATAATGTGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009480.1-968s1c1
Sequence:CCGGCCAGAGTAAAGGTGGAATCCTCTCGAGAGGATTCCACCTTTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009480.1-1169s1c1
Sequence:CCGGCATCAAGAATGACAGCAACTACTCGAGTAGTTGCTGTCATTCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009480.1-646s1c1
Sequence:CCGGGCACCACATCTGGGAGTACAACTCGAGTTGTACTCCCAGATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009480.1-753s1c1
Sequence:CCGGCCACAAGAAGTATTGCAGGGACTCGAGTCCCTGCAATACTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009480.2-1474s21c1
Sequence:CCGGGGACACTGGACACACTGAATCCTCGAGGATTCAGTGTGTCCAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009480.2-861s21c1
Sequence:CCGGGAAACGGAGGGCTCAACATAACTCGAGTTATGTTGAGCCCTCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009480.2-669s21c1
Sequence:CCGGGAGTACTACAGCTGTTGTTACCTCGAGGTAACAACAGCTGTAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009480.2-1000s21c1
Sequence:CCGGTCCAAAGCCTGTGATTATATCCTCGAGGATATAATCACAGGCTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009480.2-601s21c1
Sequence:CCGGGCTGAGACACATTATACATATCTCGAGATATGTATAATGTGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009480
VALIDATED
USF1 MISSION shRNA shRNA Plasmid DNA
upstream transcription factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009480.1-591s1c1
Sequence:CCGGGCTGAGACACATTATACATATCTCGAGATATGTATAATGTGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009480.1-968s1c1
Sequence:CCGGCCAGAGTAAAGGTGGAATCCTCTCGAGAGGATTCCACCTTTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009480.1-1169s1c1
Sequence:CCGGCATCAAGAATGACAGCAACTACTCGAGTAGTTGCTGTCATTCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009480.1-646s1c1
Sequence:CCGGGCACCACATCTGGGAGTACAACTCGAGTTGTACTCCCAGATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009480.1-753s1c1
Sequence:CCGGCCACAAGAAGTATTGCAGGGACTCGAGTCCCTGCAATACTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009480.2-1474s21c1
Sequence:CCGGGGACACTGGACACACTGAATCCTCGAGGATTCAGTGTGTCCAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009480.2-861s21c1
Sequence:CCGGGAAACGGAGGGCTCAACATAACTCGAGTTATGTTGAGCCCTCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009480.2-669s21c1
Sequence:CCGGGAGTACTACAGCTGTTGTTACCTCGAGGTAACAACAGCTGTAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009480.2-1000s21c1
Sequence:CCGGTCCAAAGCCTGTGATTATATCCTCGAGGATATAATCACAGGCTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009480.2-601s21c1
Sequence:CCGGGCTGAGACACATTATACATATCTCGAGATATGTATAATGTGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009480
VALIDATED
USF1 MISSION shRNA Lentiviral Transduction Particles
upstream transcription factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009480.1-591s1c1
Sequence:CCGGGCTGAGACACATTATACATATCTCGAGATATGTATAATGTGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009480.1-968s1c1
Sequence:CCGGCCAGAGTAAAGGTGGAATCCTCTCGAGAGGATTCCACCTTTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009480.1-1169s1c1
Sequence:CCGGCATCAAGAATGACAGCAACTACTCGAGTAGTTGCTGTCATTCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009480.1-646s1c1
Sequence:CCGGGCACCACATCTGGGAGTACAACTCGAGTTGTACTCCCAGATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009480.1-753s1c1
Sequence:CCGGCCACAAGAAGTATTGCAGGGACTCGAGTCCCTGCAATACTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009480.2-1474s21c1
Sequence:CCGGGGACACTGGACACACTGAATCCTCGAGGATTCAGTGTGTCCAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009480.2-861s21c1
Sequence:CCGGGAAACGGAGGGCTCAACATAACTCGAGTTATGTTGAGCCCTCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009480.2-669s21c1
Sequence:CCGGGAGTACTACAGCTGTTGTTACCTCGAGGTAACAACAGCTGTAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009480.2-1000s21c1
Sequence:CCGGTCCAAAGCCTGTGATTATATCCTCGAGGATATAATCACAGGCTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009480.2-601s21c1
Sequence:CCGGGCTGAGACACATTATACATATCTCGAGATATGTATAATGTGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007122
VALIDATED
USF1 MISSION shRNA Bacterial Glycerol Stock
upstream transcription factor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_007122.2-1324s1c1
Sequence:CCGGGCTGGATACTGGACACACTAACTCGAGTTAGTGTGTCCAGTATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_007122.2-1014s1c1
Sequence:CCGGCCACGGATTAGAGGTCGTCATCTCGAGATGACGACCTCTAATCCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007122.2-588s1c1
Sequence:CCGGCACTGGTCAATTCTTTGTGATCTCGAGATCACAAAGAATTGACCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007122.3-1525s21c1
Sequence:CCGGTTCCCTGGAGCTGAGGTTTAGCTCGAGCTAAACCTCAGCTCCAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007122.3-732s21c1
Sequence:CCGGCCCTAGGACTCACCCTTATTCCTCGAGGAATAAGGGTGAGTCCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007122.3-909s21c1
Sequence:CCGGGAGTAAAGGTGGGATTCTATCCTCGAGGATAGAATCCCACCTTTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007122.3-524s21c1
Sequence:CCGGCAGCTGCTGAGACGCACTATACTCGAGTATAGTGCGTCTCAGCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007122.3-1033s21c1
Sequence:CCGGCAACAGGTGGAAGATCTTAAACTCGAGTTTAAGATCTTCCACCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007122
VALIDATED
USF1 MISSION shRNA shRNA Plasmid DNA
upstream transcription factor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_007122.2-1324s1c1
Sequence:CCGGGCTGGATACTGGACACACTAACTCGAGTTAGTGTGTCCAGTATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_007122.2-1014s1c1
Sequence:CCGGCCACGGATTAGAGGTCGTCATCTCGAGATGACGACCTCTAATCCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007122.2-588s1c1
Sequence:CCGGCACTGGTCAATTCTTTGTGATCTCGAGATCACAAAGAATTGACCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007122.3-1525s21c1
Sequence:CCGGTTCCCTGGAGCTGAGGTTTAGCTCGAGCTAAACCTCAGCTCCAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007122.3-732s21c1
Sequence:CCGGCCCTAGGACTCACCCTTATTCCTCGAGGAATAAGGGTGAGTCCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007122.3-909s21c1
Sequence:CCGGGAGTAAAGGTGGGATTCTATCCTCGAGGATAGAATCCCACCTTTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007122.3-524s21c1
Sequence:CCGGCAGCTGCTGAGACGCACTATACTCGAGTATAGTGCGTCTCAGCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007122.3-1033s21c1
Sequence:CCGGCAACAGGTGGAAGATCTTAAACTCGAGTTTAAGATCTTCCACCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007122
VALIDATED
USF1 MISSION shRNA Lentiviral Transduction Particles
upstream transcription factor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_007122.2-1324s1c1
Sequence:CCGGGCTGGATACTGGACACACTAACTCGAGTTAGTGTGTCCAGTATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_007122.2-1014s1c1
Sequence:CCGGCCACGGATTAGAGGTCGTCATCTCGAGATGACGACCTCTAATCCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007122.2-588s1c1
Sequence:CCGGCACTGGTCAATTCTTTGTGATCTCGAGATCACAAAGAATTGACCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007122.3-1525s21c1
Sequence:CCGGTTCCCTGGAGCTGAGGTTTAGCTCGAGCTAAACCTCAGCTCCAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007122.3-732s21c1
Sequence:CCGGCCCTAGGACTCACCCTTATTCCTCGAGGAATAAGGGTGAGTCCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007122.3-909s21c1
Sequence:CCGGGAGTAAAGGTGGGATTCTATCCTCGAGGATAGAATCCCACCTTTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007122.3-524s21c1
Sequence:CCGGCAGCTGCTGAGACGCACTATACTCGAGTATAGTGCGTCTCAGCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007122.3-1033s21c1
Sequence:CCGGCAACAGGTGGAAGATCTTAAACTCGAGTTTAAGATCTTCCACCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks