EMAIL THIS PAGE TO A FRIEND

USF2

upstream transcription factor 2, c-fos interacting

Synonyms: FIP bHLHb12
Gene ID:
Human(7392) Summary: This gene encodes a member of the basic helix-loop-helix leucine zipper family, and can function as a cellular transcription factor. The encoded protein can activate transcription through pyrimidine-rich initiator (Inr) elements and E-box motifs. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(22282) upstream transcription factor 2
Rat(81817) upstream transcription factor 2, c-fos interacting
Zebrafish(567297) upstream transcription factor 2, c-fos interacting
chicken(100861414) upstream stimulatory factor 2
dog(612662) upstream transcription factor 2, c-fos interacting
domestic cat(101101275) upstream transcription factor 2, c-fos interacting
cow(407240) upstream transcription factor 2, c-fos interacting
sheep(101102584) upstream transcription factor 2, c-fos interacting
Domestic Rabbit(100008893) upstream transcription factor 2, c-fos interacting
naked mole-rat(101699631) upstream transcription factor 2, c-fos interacting
domestic guinea pig(100732650) upstream transcription factor 2, c-fos interacting
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406574 Anti-USF2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1412650 ANTI-USF2 antibody produced in mouse clone 6A9, purified immunoglobulin, buffered aqueous solution human,
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV33482 Anti-USF2 antibody produced in rabbit affinity isolated antibody mouse, rat, guinea pig, human, bovine, zebrafish, rabbit
western blot pricing
SAB2102660 Anti-USF2 antibody produced in rabbit affinity isolated antibody mouse, rat, human, bovine, rabbit, guinea pig, rabbit
western blot pricing
SAB4503063 Anti-USF2 antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
HPA029764 Anti-USF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
HPA046567 Anti-USF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0007392M1 Monoclonal Anti-USF2 antibody produced in mouse clone 5E9, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404519 Monoclonal Anti-USF2, (N-terminal) antibody produced in mouse clone 5F2, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011680 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011680 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011680 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003367 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003367 Rosetta Predictions human pricing
NM_207291 Rosetta Predictions human pricing
NM_031139 Rosetta Predictions rat pricing
NM_011680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017395 predicted 890
2 SASI_Hs01_00017396 predicted 893
3 SASI_Hs01_00017397 predicted 951
4 SASI_Hs01_00017398 predicted 1050
5 SASI_Hs01_00017399 predicted 860
6 SASI_Hs01_00017401 predicted 965
7 SASI_Hs01_00017402 predicted 895
8 SASI_Hs01_00017403 predicted 965
9 SASI_Hs02_00335521 predicted 908
10 SASI_Hs01_00017394 predicted 1287
11 SASI_Hs01_00017400 predicted 1293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121017 predicted 693
2 SASI_Hs01_00121018 predicted 692
3 SASI_Hs01_00121019 predicted 754
4 SASI_Hs01_00121020 predicted 858
5 SASI_Hs01_00121021 predicted 665
6 SASI_Hs01_00121023 predicted 766
7 SASI_Hs01_00121024 predicted 692
8 SASI_Hs01_00121025 predicted 765
9 SASI_Hs02_00373821 predicted 714
10 SASI_Hs01_00121016 predicted 1089
11 SASI_Hs01_00121022 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036533 predicted 926
2 SASI_Rn01_00036534 predicted 1379
3 SASI_Rn02_00264476 predicted 1247
4 SASI_Rn01_00036535 predicted 1043
5 SASI_Rn01_00036536 predicted 1343
6 SASI_Rn01_00036537 predicted 1020
7 SASI_Rn01_00036538 predicted 1073
8 SASI_Rn01_00036539 predicted 1018
9 SASI_Rn01_00036540 predicted 1289
10 SASI_Rn01_00036541 predicted 1262
11 SASI_Rn01_00036542 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020336 predicted 477
2 SASI_Mm01_00020337 predicted 1262
3 SASI_Mm01_00020338 predicted 592
4 SASI_Mm02_00321220 predicted 575
5 SASI_Mm02_00321221 predicted 795
6 SASI_Mm01_00020341 predicted 622
7 SASI_Mm01_00020343 predicted 819
8 SASI_Mm01_00020344 predicted 867
9 SASI_Mm02_00321222 predicted 773
10 SASI_Mm01_00020345 predicted 570
11 SASI_Mm01_00020339 predicted 1073
12 SASI_Mm01_00020340 predicted 895
13 SASI_Mm01_00020342 predicted 1071
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011680
VALIDATED
USF2 MISSION shRNA Bacterial Glycerol Stock
upstream transcription factor 2, c-fos interacting
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011680.2-668s21c1
Sequence:CCGGACAGGCACACAGAGGACAATTCTCGAGAATTGTCCTCTGTGTGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011680.2-855s21c1
Sequence:CCGGGCAAGACAGGAGCAAGTAAAGCTCGAGCTTTACTTGCTCCTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011680.2-1311s21c1
Sequence:CCGGCCTCACCAGCCCATCACTTATCTCGAGATAAGTGATGGGCTGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011680.2-1208s21c1
Sequence:CCGGACAAGGAGACATAATGCATTTCTCGAGAAATGCATTATGTCTCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011680.2-1388s21c1
Sequence:CCGGTCCTTGGTCTCTAGAGGTATTCTCGAGAATACCTCTAGAGACCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011680.1-260s1c1
Sequence:CCGGCCAGTTCCGTACAGAGAGTAACTCGAGTTACTCTCTGTACGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011680.1-902s1c1
Sequence:CCGGGTCCAAGGCTTGCGATTACATCTCGAGATGTAATCGCAAGCCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011680.1-242s1c1
Sequence:CCGGCGACCACAATATCCAGTACCACTCGAGTGGTACTGGATATTGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011680.1-751s1c1
Sequence:CCGGCTCCTCGAGATGAGAGAAGAACTCGAGTTCTTCTCTCATCTCGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011680.1-595s1c1
Sequence:CCGGCCACAGCTGTGTCTGTTCAAACTCGAGTTTGAACAGACACAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011680
VALIDATED
USF2 MISSION shRNA shRNA Plasmid DNA
upstream transcription factor 2, c-fos interacting
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011680.2-668s21c1
Sequence:CCGGACAGGCACACAGAGGACAATTCTCGAGAATTGTCCTCTGTGTGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011680.2-855s21c1
Sequence:CCGGGCAAGACAGGAGCAAGTAAAGCTCGAGCTTTACTTGCTCCTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011680.2-1311s21c1
Sequence:CCGGCCTCACCAGCCCATCACTTATCTCGAGATAAGTGATGGGCTGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011680.2-1208s21c1
Sequence:CCGGACAAGGAGACATAATGCATTTCTCGAGAAATGCATTATGTCTCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011680.2-1388s21c1
Sequence:CCGGTCCTTGGTCTCTAGAGGTATTCTCGAGAATACCTCTAGAGACCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011680.1-260s1c1
Sequence:CCGGCCAGTTCCGTACAGAGAGTAACTCGAGTTACTCTCTGTACGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011680.1-902s1c1
Sequence:CCGGGTCCAAGGCTTGCGATTACATCTCGAGATGTAATCGCAAGCCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011680.1-242s1c1
Sequence:CCGGCGACCACAATATCCAGTACCACTCGAGTGGTACTGGATATTGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011680.1-751s1c1
Sequence:CCGGCTCCTCGAGATGAGAGAAGAACTCGAGTTCTTCTCTCATCTCGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011680.1-595s1c1
Sequence:CCGGCCACAGCTGTGTCTGTTCAAACTCGAGTTTGAACAGACACAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011680
VALIDATED
USF2 MISSION shRNA Lentiviral Transduction Particles
upstream transcription factor 2, c-fos interacting
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011680.2-668s21c1
Sequence:CCGGACAGGCACACAGAGGACAATTCTCGAGAATTGTCCTCTGTGTGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011680.2-855s21c1
Sequence:CCGGGCAAGACAGGAGCAAGTAAAGCTCGAGCTTTACTTGCTCCTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011680.2-1311s21c1
Sequence:CCGGCCTCACCAGCCCATCACTTATCTCGAGATAAGTGATGGGCTGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011680.2-1208s21c1
Sequence:CCGGACAAGGAGACATAATGCATTTCTCGAGAAATGCATTATGTCTCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011680.2-1388s21c1
Sequence:CCGGTCCTTGGTCTCTAGAGGTATTCTCGAGAATACCTCTAGAGACCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011680.1-260s1c1
Sequence:CCGGCCAGTTCCGTACAGAGAGTAACTCGAGTTACTCTCTGTACGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011680.1-902s1c1
Sequence:CCGGGTCCAAGGCTTGCGATTACATCTCGAGATGTAATCGCAAGCCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011680.1-242s1c1
Sequence:CCGGCGACCACAATATCCAGTACCACTCGAGTGGTACTGGATATTGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011680.1-751s1c1
Sequence:CCGGCTCCTCGAGATGAGAGAAGAACTCGAGTTCTTCTCTCATCTCGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011680.1-595s1c1
Sequence:CCGGCCACAGCTGTGTCTGTTCAAACTCGAGTTTGAACAGACACAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003367
VALIDATED
USF2 MISSION shRNA Bacterial Glycerol Stock
upstream transcription factor 2, c-fos interacting
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003367.2-760s21c1
Sequence:CCGGGACACACCCTTACTCTCCAAACTCGAGTTTGGAGAGTAAGGGTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003367.2-286s21c1
Sequence:CCGGCGGCGACCACAACATCCAGTACTCGAGTACTGGATGTTGTGGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003367.2-895s21c1
Sequence:CCGGTCCAGACTGTAACGCAGACAACTCGAGTTGTCTGCGTTACAGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003367.2-1327s21c1
Sequence:CCGGTCCTCCACTTGGAAACGGTATCTCGAGATACCGTTTCCAAGTGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003367.1-651s1c1
Sequence:CCGGGACACACCCTTACTCTCCAAACTCGAGTTTGGAGAGTAAGGGTGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003367.1-786s1c1
Sequence:CCGGTCCAGACTGTAACGCAGACAACTCGAGTTGTCTGCGTTACAGTCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003367.1-1218s1c1
Sequence:CCGGTCCTCCACTTGGAAACGGTATCTCGAGATACCGTTTCCAAGTGGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003367
VALIDATED
USF2 MISSION shRNA shRNA Plasmid DNA
upstream transcription factor 2, c-fos interacting
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003367.2-760s21c1
Sequence:CCGGGACACACCCTTACTCTCCAAACTCGAGTTTGGAGAGTAAGGGTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003367.2-286s21c1
Sequence:CCGGCGGCGACCACAACATCCAGTACTCGAGTACTGGATGTTGTGGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003367.2-895s21c1
Sequence:CCGGTCCAGACTGTAACGCAGACAACTCGAGTTGTCTGCGTTACAGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003367.2-1327s21c1
Sequence:CCGGTCCTCCACTTGGAAACGGTATCTCGAGATACCGTTTCCAAGTGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003367.1-651s1c1
Sequence:CCGGGACACACCCTTACTCTCCAAACTCGAGTTTGGAGAGTAAGGGTGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003367.1-786s1c1
Sequence:CCGGTCCAGACTGTAACGCAGACAACTCGAGTTGTCTGCGTTACAGTCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003367.1-1218s1c1
Sequence:CCGGTCCTCCACTTGGAAACGGTATCTCGAGATACCGTTTCCAAGTGGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003367
VALIDATED
USF2 MISSION shRNA Lentiviral Transduction Particles
upstream transcription factor 2, c-fos interacting
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003367.2-760s21c1
Sequence:CCGGGACACACCCTTACTCTCCAAACTCGAGTTTGGAGAGTAAGGGTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003367.2-286s21c1
Sequence:CCGGCGGCGACCACAACATCCAGTACTCGAGTACTGGATGTTGTGGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003367.2-895s21c1
Sequence:CCGGTCCAGACTGTAACGCAGACAACTCGAGTTGTCTGCGTTACAGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003367.2-1327s21c1
Sequence:CCGGTCCTCCACTTGGAAACGGTATCTCGAGATACCGTTTCCAAGTGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003367.1-651s1c1
Sequence:CCGGGACACACCCTTACTCTCCAAACTCGAGTTTGGAGAGTAAGGGTGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003367.1-786s1c1
Sequence:CCGGTCCAGACTGTAACGCAGACAACTCGAGTTGTCTGCGTTACAGTCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003367.1-1218s1c1
Sequence:CCGGTCCTCCACTTGGAAACGGTATCTCGAGATACCGTTTCCAAGTGGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks