EMAIL THIS PAGE TO A FRIEND

USH1C

Usher syndrome 1C (autosomal recessive, severe)

Synonyms: AIE-75 DFNB18 DFNB18A NY-CO-37 NY-CO-38 PDZ-45 PDZ-73 PDZ-73/NY-CO-38 PDZ73 PDZD7C ush1cpst
Gene ID:
Human(10083) Summary: This gene encodes a scaffold protein that functions in the assembly of Usher protein complexes. The protein contains PDZ domains, a coiled-coil region with a bipartite nuclear localization signal and a PEST degradation sequence. Defects in this gene are the cause of Usher syndrome type 1C and non-syndromic sensorineural deafness autosomal recessive type 18. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(72088) Usher syndrome 1C
Rat(308596) Usher syndrome 1C
Zebrafish(564412) Usher syndrome 1C (autosomal recessive, severe)
chicken(423073) Usher syndrome 1C (autosomal recessive, severe)
domestic cat(101097416) Usher syndrome 1C (autosomal recessive, severe)
Horse(100146507) Usher syndrome 1C (autosomal recessive, severe)
dog(610850) Usher syndrome 1C (autosomal recessive, severe)
cow(530709) Usher syndrome 1C (autosomal recessive, severe)
sheep(101120271) Usher syndrome 1C (autosomal recessive, severe)
domestic guinea pig(100722968) Usher syndrome 1C (autosomal recessive, severe)
naked mole-rat(101707224) Usher syndrome 1C (autosomal recessive, severe)
Domestic Rabbit(100345203) Usher syndrome 1C (autosomal recessive, severe)
141 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023649 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023649 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023649 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005709 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005709 Rosetta Predictions human pricing
NM_153676 Rosetta Predictions human pricing
NM_212521 Rosetta Predictions rat pricing
XM_001078228 Rosetta Predictions rat pricing
XM_001078253 Rosetta Predictions rat pricing
XM_001078271 Rosetta Predictions rat pricing
XM_001080105 Rosetta Predictions rat pricing
XM_001080112 Rosetta Predictions rat pricing
XM_001080121 Rosetta Predictions rat pricing
NM_023649 Rosetta Predictions mouse pricing
NM_153677 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141221 predicted 807
2 SASI_Hs01_00141224 predicted 892
3 SASI_Hs01_00141225 predicted 583
4 SASI_Hs01_00141226 predicted 508
5 SASI_Hs01_00141227 predicted 931
6 SASI_Hs01_00141228 predicted 236
7 SASI_Hs01_00141229 predicted 874
8 SASI_Hs02_00340128 predicted 650
9 SASI_Hs02_00340129 predicted 440
10 SASI_Hs02_00340130 predicted 501
11 SASI_Hs01_00141222 predicted 653
12 SASI_Hs01_00141223 predicted 799
13 SASI_Hs01_00141230 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040937 predicted 803
2 SASI_Hs01_00040940 predicted 898
3 SASI_Hs01_00040941 predicted 581
4 SASI_Hs01_00040942 predicted 507
5 SASI_Hs01_00040943 predicted 923
6 SASI_Hs01_00040944 predicted 230
7 SASI_Hs01_00040945 predicted 869
8 SASI_Hs02_00367393 predicted 653
9 SASI_Hs02_00367394 predicted 435
10 SASI_Hs02_00367395 predicted 497
11 SASI_Hs01_00040938 predicted 650
12 SASI_Hs01_00040939 predicted 797
13 SASI_Hs01_00040946 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212521 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270535 predicted 1619
2 SASI_Rn02_00270536 predicted 517
3 SASI_Rn02_00270537 predicted 829
4 SASI_Rn02_00270538 predicted 556
5 SASI_Rn02_00270539 predicted 886
6 SASI_Rn02_00270540 predicted 668
7 SASI_Rn02_00270541 predicted 735
8 SASI_Rn02_00270542 predicted 876
9 SASI_Rn02_00270543 predicted 1088
10 SASI_Rn02_00270544 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360037 predicted 688
2 SASI_Rn02_00360038 predicted 466
3 SASI_Rn02_00360039 predicted 624
4 SASI_Rn02_00360040 predicted 473
5 SASI_Rn02_00360041 predicted 654
6 SASI_Rn02_00360042 predicted 514
7 SASI_Rn02_00360043 predicted 614
8 SASI_Rn02_00360044 predicted 685
9 SASI_Rn02_00360045 predicted 540
10 SASI_Rn02_00360046 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360116 predicted 689
2 SASI_Rn02_00360117 predicted 468
3 SASI_Rn02_00360118 predicted 628
4 SASI_Rn02_00360119 predicted 465
5 SASI_Rn02_00360120 predicted 660
6 SASI_Rn02_00360121 predicted 514
7 SASI_Rn02_00360122 predicted 617
8 SASI_Rn02_00360123 predicted 684
9 SASI_Rn02_00360124 predicted 541
10 SASI_Rn02_00360125 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078271 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360207 predicted 740
2 SASI_Rn02_00360208 predicted 516
3 SASI_Rn02_00360209 predicted 683
4 SASI_Rn02_00360210 predicted 519
5 SASI_Rn02_00360211 predicted 708
6 SASI_Rn02_00360212 predicted 564
7 SASI_Rn02_00360213 predicted 673
8 SASI_Rn02_00360214 predicted 735
9 SASI_Rn02_00360215 predicted 599
10 SASI_Rn02_00360216 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366618 predicted 1487
2 SASI_Rn02_00366619 predicted 2281
3 SASI_Rn02_00366620 predicted 2272
4 SASI_Rn02_00366621 predicted 1501
5 SASI_Rn02_00366622 predicted 465
6 SASI_Rn02_00366623 predicted 2210
7 SASI_Rn02_00366624 predicted 781
8 SASI_Rn02_00366625 predicted 769
9 SASI_Rn02_00366626 predicted 508
10 SASI_Rn02_00366627 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366648 predicted 1486
2 SASI_Rn02_00366649 predicted 2273
3 SASI_Rn02_00366650 predicted 1493
4 SASI_Rn02_00366651 predicted 467
5 SASI_Rn02_00366652 predicted 2210
6 SASI_Rn02_00366653 predicted 2654
7 SASI_Rn02_00366654 predicted 787
8 SASI_Rn02_00366655 predicted 761
9 SASI_Rn02_00366656 predicted 505
10 SASI_Rn02_00366657 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080121 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366708 predicted 1623
2 SASI_Rn02_00366709 predicted 519
3 SASI_Rn02_00366710 predicted 838
4 SASI_Rn02_00366711 predicted 562
5 SASI_Rn02_00366712 predicted 888
6 SASI_Rn02_00366713 predicted 669
7 SASI_Rn02_00366714 predicted 741
8 SASI_Rn02_00366715 predicted 883
9 SASI_Rn02_00366716 predicted 1096
10 SASI_Rn02_00366717 predicted 1223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168772 predicted 826
2 SASI_Mm01_00168773 predicted 644
3 SASI_Mm01_00168774 predicted 355
4 SASI_Mm01_00168775 predicted 651
5 SASI_Mm01_00168776 predicted 649
6 SASI_Mm01_00168777 predicted 485
7 SASI_Mm01_00168778 predicted 287
8 SASI_Mm01_00168779 predicted 470
9 SASI_Mm01_00168780 predicted 573
10 SASI_Mm01_00168781 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045103 predicted 834
2 SASI_Mm01_00045104 predicted 650
3 SASI_Mm01_00045105 predicted 357
4 SASI_Mm01_00045106 predicted 653
5 SASI_Mm01_00045107 predicted 649
6 SASI_Mm01_00045108 predicted 485
7 SASI_Mm01_00045109 predicted 290
8 SASI_Mm01_00045110 predicted 470
9 SASI_Mm01_00045111 predicted 574
10 SASI_Mm01_00045112 predicted 786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023649
USH1C MISSION shRNA Bacterial Glycerol Stock
Usher syndrome 1C (autosomal recessive, severe)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023649.1-1862s1c1
Sequence:CCGGGTAGGGTTCCATCTCCCATTTCTCGAGAAATGGGAGATGGAACCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023649.1-1605s1c1
Sequence:CCGGGACTGGATAGACCTTGTGGTTCTCGAGAACCACAAGGTCTATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023649.1-792s1c1
Sequence:CCGGGACCAGATTGTGGAAGTCAATCTCGAGATTGACTTCCACAATCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023649.1-167s1c1
Sequence:CCGGGCTGGTCATCAATGAACCCAACTCGAGTTGGGTTCATTGATGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023649.1-558s1c1
Sequence:CCGGGAGTCCCTCAAATGGCAGTATCTCGAGATACTGCCATTTGAGGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023649.2-781s21c1
Sequence:CCGGTAGAGACAGGAGACCAGATTGCTCGAGCAATCTGGTCTCCTGTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023649
USH1C MISSION shRNA shRNA Plasmid DNA
Usher syndrome 1C (autosomal recessive, severe)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023649.1-1862s1c1
Sequence:CCGGGTAGGGTTCCATCTCCCATTTCTCGAGAAATGGGAGATGGAACCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023649.1-1605s1c1
Sequence:CCGGGACTGGATAGACCTTGTGGTTCTCGAGAACCACAAGGTCTATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023649.1-792s1c1
Sequence:CCGGGACCAGATTGTGGAAGTCAATCTCGAGATTGACTTCCACAATCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023649.1-167s1c1
Sequence:CCGGGCTGGTCATCAATGAACCCAACTCGAGTTGGGTTCATTGATGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023649.1-558s1c1
Sequence:CCGGGAGTCCCTCAAATGGCAGTATCTCGAGATACTGCCATTTGAGGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023649.2-781s21c1
Sequence:CCGGTAGAGACAGGAGACCAGATTGCTCGAGCAATCTGGTCTCCTGTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023649
USH1C MISSION shRNA Lentiviral Transduction Particles
Usher syndrome 1C (autosomal recessive, severe)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023649.1-1862s1c1
Sequence:CCGGGTAGGGTTCCATCTCCCATTTCTCGAGAAATGGGAGATGGAACCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023649.1-1605s1c1
Sequence:CCGGGACTGGATAGACCTTGTGGTTCTCGAGAACCACAAGGTCTATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023649.1-792s1c1
Sequence:CCGGGACCAGATTGTGGAAGTCAATCTCGAGATTGACTTCCACAATCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023649.1-167s1c1
Sequence:CCGGGCTGGTCATCAATGAACCCAACTCGAGTTGGGTTCATTGATGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023649.1-558s1c1
Sequence:CCGGGAGTCCCTCAAATGGCAGTATCTCGAGATACTGCCATTTGAGGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023649.2-781s21c1
Sequence:CCGGTAGAGACAGGAGACCAGATTGCTCGAGCAATCTGGTCTCCTGTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005709
USH1C MISSION shRNA Bacterial Glycerol Stock
Usher syndrome 1C (autosomal recessive, severe)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005709.1-157s1c1
Sequence:CCGGGCAGAGAAGGACTATCTCTATCTCGAGATAGAGATAGTCCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005709.1-1386s1c1
Sequence:CCGGCCGGAAATATGAGGAAGGCTTCTCGAGAAGCCTTCCTCATATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005709.1-1614s1c1
Sequence:CCGGCGGCAAGATTGTGACAGACTACTCGAGTAGTCTGTCACAATCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005709.1-501s1c1
Sequence:CCGGCCGGATCAATGGATATTCCATCTCGAGATGGAATATCCATTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005709.1-2080s1c1
Sequence:CCGGGACTCCTTCCTTGAACCCTAACTCGAGTTAGGGTTCAAGGAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005709.3-2027s21c1
Sequence:CCGGCAAGGATCCAGACTCTCATTCCTCGAGGAATGAGAGTCTGGATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005709.3-876s21c1
Sequence:CCGGACCAGATTGTCGAAGTCAATGCTCGAGCATTGACTTCGACAATCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005709
USH1C MISSION shRNA shRNA Plasmid DNA
Usher syndrome 1C (autosomal recessive, severe)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005709.1-157s1c1
Sequence:CCGGGCAGAGAAGGACTATCTCTATCTCGAGATAGAGATAGTCCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005709.1-1386s1c1
Sequence:CCGGCCGGAAATATGAGGAAGGCTTCTCGAGAAGCCTTCCTCATATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005709.1-1614s1c1
Sequence:CCGGCGGCAAGATTGTGACAGACTACTCGAGTAGTCTGTCACAATCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005709.1-501s1c1
Sequence:CCGGCCGGATCAATGGATATTCCATCTCGAGATGGAATATCCATTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005709.1-2080s1c1
Sequence:CCGGGACTCCTTCCTTGAACCCTAACTCGAGTTAGGGTTCAAGGAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005709.3-2027s21c1
Sequence:CCGGCAAGGATCCAGACTCTCATTCCTCGAGGAATGAGAGTCTGGATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005709.3-876s21c1
Sequence:CCGGACCAGATTGTCGAAGTCAATGCTCGAGCATTGACTTCGACAATCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005709
USH1C MISSION shRNA Lentiviral Transduction Particles
Usher syndrome 1C (autosomal recessive, severe)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005709.1-157s1c1
Sequence:CCGGGCAGAGAAGGACTATCTCTATCTCGAGATAGAGATAGTCCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005709.1-1386s1c1
Sequence:CCGGCCGGAAATATGAGGAAGGCTTCTCGAGAAGCCTTCCTCATATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005709.1-1614s1c1
Sequence:CCGGCGGCAAGATTGTGACAGACTACTCGAGTAGTCTGTCACAATCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005709.1-501s1c1
Sequence:CCGGCCGGATCAATGGATATTCCATCTCGAGATGGAATATCCATTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005709.1-2080s1c1
Sequence:CCGGGACTCCTTCCTTGAACCCTAACTCGAGTTAGGGTTCAAGGAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005709.3-2027s21c1
Sequence:CCGGCAAGGATCCAGACTCTCATTCCTCGAGGAATGAGAGTCTGGATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005709.3-876s21c1
Sequence:CCGGACCAGATTGTCGAAGTCAATGCTCGAGCATTGACTTCGACAATCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks