EMAIL THIS PAGE TO A FRIEND

USH1G

Usher syndrome 1G (autosomal recessive)

Synonyms: ANKS4A SANS
UniProtKB ID: Q495M9, Q8N251
Gene ID:
Human(124590) Summary: This gene encodes a protein that contains three ankyrin domains, a class I PDZ-binding motif and a sterile alpha motif. The encoded protein interacts with harmonin, which is associated with Usher syndrome type 1C. This protein plays a role in the development and maintenance of the auditory and visual systems and functions in the cohesion of hair bundles formed by inner ear sensory cells. Mutations in this gene are associated with Usher syndrome type 1G (USH1G). [provided by RefSeq, Jul 2008]
Mouse(16470) Usher syndrome 1G
Rat(287819) Usher syndrome 1G
Zebrafish(557135) Usher syndrome 1G (autosomal recessive)
chicken(428684) Usher syndrome 1G (autosomal recessive)
Horse(100052352) Usher syndrome 1G (autosomal recessive)
domestic cat(101096932) Usher syndrome 1G (autosomal recessive)
dog(609705) Usher syndrome 1G (autosomal recessive)
naked mole-rat(101702263) Usher syndrome 1G (autosomal recessive)
domestic guinea pig(100714552) Usher syndrome 1G (autosomal recessive)
cow(531104) Usher syndrome 1G (autosomal recessive)
sheep(101102406) Usher syndrome 1G (autosomal recessive)
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173477 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176847 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176847 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176847 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173477 Rosetta Predictions human pricing
NM_001105850 Rosetta Predictions rat pricing
NM_176847 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176350 predicted 991
2 SASI_Hs02_00368234 predicted 498
3 SASI_Hs01_00176351 predicted 484
4 SASI_Hs01_00176352 predicted 1428
5 SASI_Hs01_00176353 predicted 300
6 SASI_Hs01_00176354 predicted 1292
7 SASI_Hs01_00176355 predicted 1122
8 SASI_Hs01_00176356 predicted 571
9 SASI_Hs01_00176357 predicted 1702
10 SASI_Hs01_00176358 predicted 1822
11 SASI_Hs01_00176359 predicted 2076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213142 predicted 323
2 SASI_Rn02_00213143 predicted 744
3 SASI_Rn02_00213144 predicted 930
4 SASI_Rn02_00213145 predicted 816
5 SASI_Rn02_00213146 predicted 299
6 SASI_Rn02_00213147 predicted 934
7 SASI_Rn02_00213148 predicted 310
8 SASI_Rn02_00213149 predicted 973
9 SASI_Rn02_00213150 predicted 207
10 SASI_Rn02_00213151 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346755 predicted 807
2 SASI_Mm01_00056887 predicted 1535
3 SASI_Mm01_00056888 predicted 382
4 SASI_Mm01_00056889 predicted 990
5 SASI_Mm01_00056890 predicted 877
6 SASI_Mm01_00056892 predicted 953
7 SASI_Mm01_00056893 predicted 370
8 SASI_Mm02_00346756 predicted 386
9 SASI_Mm01_00056894 predicted 388
10 SASI_Mm01_00056895 predicted 357
11 SASI_Mm01_00056891 predicted 1879
12 SASI_Mm01_00056896 predicted 1923
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173477
USH1G MISSION shRNA Bacterial Glycerol Stock
Usher syndrome 1G (autosomal recessive)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173477.2-457s21c1
Sequence:CCGGTGGTGCCTAGACAACGACTACCTCGAGGTAGTCGTTGTCTAGGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173477.2-1550s21c1
Sequence:CCGGTGGAGGACACAGAGCTATAACCTCGAGGTTATAGCTCTGTGTCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173477.2-2006s1c1
Sequence:CCGGCCTGCATTGTTGTGAAGGGAACTCGAGTTCCCTTCACAACAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173477.2-1124s1c1
Sequence:CCGGCCATGGTGTTCCGCAGAAATTCTCGAGAATTTCTGCGGAACACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173477.2-510s1c1
Sequence:CCGGCCACATGGAATGCGTGCGCTACTCGAGTAGCGCACGCATTCCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173477.2-1300s1c1
Sequence:CCGGCCCTGGGATGAGCTCGATTTACTCGAGTAAATCGAGCTCATCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173477.2-241s1c1
Sequence:CCGGGCCACCCGAAAGGAGCTGAATCTCGAGATTCAGCTCCTTTCGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173477
USH1G MISSION shRNA shRNA Plasmid DNA
Usher syndrome 1G (autosomal recessive)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173477.2-457s21c1
Sequence:CCGGTGGTGCCTAGACAACGACTACCTCGAGGTAGTCGTTGTCTAGGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173477.2-1550s21c1
Sequence:CCGGTGGAGGACACAGAGCTATAACCTCGAGGTTATAGCTCTGTGTCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173477.2-2006s1c1
Sequence:CCGGCCTGCATTGTTGTGAAGGGAACTCGAGTTCCCTTCACAACAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173477.2-1124s1c1
Sequence:CCGGCCATGGTGTTCCGCAGAAATTCTCGAGAATTTCTGCGGAACACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173477.2-510s1c1
Sequence:CCGGCCACATGGAATGCGTGCGCTACTCGAGTAGCGCACGCATTCCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173477.2-1300s1c1
Sequence:CCGGCCCTGGGATGAGCTCGATTTACTCGAGTAAATCGAGCTCATCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173477.2-241s1c1
Sequence:CCGGGCCACCCGAAAGGAGCTGAATCTCGAGATTCAGCTCCTTTCGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173477
USH1G MISSION shRNA Lentiviral Transduction Particles
Usher syndrome 1G (autosomal recessive)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173477.2-457s21c1
Sequence:CCGGTGGTGCCTAGACAACGACTACCTCGAGGTAGTCGTTGTCTAGGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173477.2-1550s21c1
Sequence:CCGGTGGAGGACACAGAGCTATAACCTCGAGGTTATAGCTCTGTGTCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173477.2-2006s1c1
Sequence:CCGGCCTGCATTGTTGTGAAGGGAACTCGAGTTCCCTTCACAACAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173477.2-1124s1c1
Sequence:CCGGCCATGGTGTTCCGCAGAAATTCTCGAGAATTTCTGCGGAACACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173477.2-510s1c1
Sequence:CCGGCCACATGGAATGCGTGCGCTACTCGAGTAGCGCACGCATTCCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173477.2-1300s1c1
Sequence:CCGGCCCTGGGATGAGCTCGATTTACTCGAGTAAATCGAGCTCATCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173477.2-241s1c1
Sequence:CCGGGCCACCCGAAAGGAGCTGAATCTCGAGATTCAGCTCCTTTCGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176847
USH1G MISSION shRNA Bacterial Glycerol Stock
Usher syndrome 1G (autosomal recessive)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176847.3-1255s21c1
Sequence:CCGGCGCTGCACATGGAAGACTTTGCTCGAGCAAAGTCTTCCATGTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176847.3-1006s21c1
Sequence:CCGGTGGTGTTTCGAAGGAACTATGCTCGAGCATAGTTCCTTCGAAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176847.3-808s21c1
Sequence:CCGGTGGGTAGTGATGTGATGTTTGCTCGAGCAAACATCACATCACTACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176847.3-331s21c1
Sequence:CCGGACATCTGGTGCCTGGACAATGCTCGAGCATTGTCCAGGCACCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176847.3-2673s21c1
Sequence:CCGGAGCAATATCACCGAGGTTATGCTCGAGCATAACCTCGGTGATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176111    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176847.2-1708s1c1
Sequence:CCGGGCTCTGAATTACAAGAGGATTCTCGAGAATCCTCTTGTAATTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176847
USH1G MISSION shRNA shRNA Plasmid DNA
Usher syndrome 1G (autosomal recessive)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176847.3-1255s21c1
Sequence:CCGGCGCTGCACATGGAAGACTTTGCTCGAGCAAAGTCTTCCATGTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176847.3-1006s21c1
Sequence:CCGGTGGTGTTTCGAAGGAACTATGCTCGAGCATAGTTCCTTCGAAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176847.3-808s21c1
Sequence:CCGGTGGGTAGTGATGTGATGTTTGCTCGAGCAAACATCACATCACTACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176847.3-331s21c1
Sequence:CCGGACATCTGGTGCCTGGACAATGCTCGAGCATTGTCCAGGCACCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176847.3-2673s21c1
Sequence:CCGGAGCAATATCACCGAGGTTATGCTCGAGCATAACCTCGGTGATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176111    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176847.2-1708s1c1
Sequence:CCGGGCTCTGAATTACAAGAGGATTCTCGAGAATCCTCTTGTAATTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176847
USH1G MISSION shRNA Lentiviral Transduction Particles
Usher syndrome 1G (autosomal recessive)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176847.3-1255s21c1
Sequence:CCGGCGCTGCACATGGAAGACTTTGCTCGAGCAAAGTCTTCCATGTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176847.3-1006s21c1
Sequence:CCGGTGGTGTTTCGAAGGAACTATGCTCGAGCATAGTTCCTTCGAAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176847.3-808s21c1
Sequence:CCGGTGGGTAGTGATGTGATGTTTGCTCGAGCAAACATCACATCACTACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176847.3-331s21c1
Sequence:CCGGACATCTGGTGCCTGGACAATGCTCGAGCATTGTCCAGGCACCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176847.3-2673s21c1
Sequence:CCGGAGCAATATCACCGAGGTTATGCTCGAGCATAACCTCGGTGATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176111    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176847.2-1708s1c1
Sequence:CCGGGCTCTGAATTACAAGAGGATTCTCGAGAATCCTCTTGTAATTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks