EMAIL THIS PAGE TO A FRIEND

USH2A

Usher syndrome 2A (autosomal recessive, mild)

Synonyms: RP39 US2 USH2 dJ1111A8.1
UniProtKB ID: O75445, Q5VVM9, Q6S362, Q9NS27
Gene ID:
Human(7399) Summary: This gene encodes a protein that contains laminin EGF motifs, a pentaxin domain, and many fibronectin type III motifs. The protein is found in the basement membrane, and may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIa and retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Mouse(22283) Usher syndrome 2A (autosomal recessive, mild)
Rat(289369) Usher syndrome 2A (autosomal recessive, mild)
Zebrafish(568982) Usher syndrome 2A (autosomal recessive, mild)
chicken(421358) Usher syndrome 2A (autosomal recessive, mild)
dog(488593) Usher syndrome 2A (autosomal recessive, mild)
Horse(100050607) Usher syndrome 2A (autosomal recessive, mild)
domestic cat(101091499) Usher syndrome 2A (autosomal recessive, mild)
cow(100296635) Usher syndrome 2A (autosomal recessive, mild)
sheep(101120853) Usher syndrome 2A (autosomal recessive, mild)
domestic guinea pig(100719619) Usher syndrome 2A (autosomal recessive, mild)
naked mole-rat(101700761) Usher syndrome 2A (autosomal recessive, mild)
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007123 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU153591 MISSION® esiRNA esiRNA targeting mouse Ush2a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007123 Rosetta Predictions human pricing
NM_206933 Rosetta Predictions human pricing
XM_001065756 Rosetta Predictions rat pricing
XM_223053 Rosetta Predictions rat pricing
NM_021408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342998 predicted 2399
2 SASI_Hs01_00066417 predicted 856
3 SASI_Hs01_00066418 predicted 732
4 SASI_Hs01_00066420 predicted 2309
5 SASI_Hs01_00066421 predicted 4459
6 SASI_Hs01_00066422 predicted 3242
7 SASI_Hs01_00066423 predicted 1966
8 SASI_Hs01_00066424 predicted 2538
9 SASI_Hs02_00342999 predicted 2983
10 SASI_Hs01_00066425 predicted 4020
11 SASI_Hs01_00066419 predicted 3262
12 SASI_Hs01_00066426 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049914 predicted 859
2 SASI_Hs01_00049915 predicted 730
3 SASI_Hs01_00049916 predicted 2313
4 SASI_Hs01_00049917 predicted 4457
5 SASI_Hs01_00049918 predicted 3244
6 SASI_Hs01_00049919 predicted 1964
7 SASI_Hs01_00049920 predicted 1265
8 SASI_Hs01_00049921 predicted 2546
9 SASI_Hs02_00373634 predicted 2975
10 SASI_Hs01_00049922 predicted 4020
11 SASI_Hs01_00049923 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315276 predicted 8201
2 SASI_Rn02_00315277 predicted 4794
3 SASI_Rn02_00315278 predicted 5495
4 SASI_Rn02_00315279 predicted 3974
5 SASI_Rn02_00315280 predicted 12006
6 SASI_Rn02_00315281 predicted 8386
7 SASI_Rn02_00315282 predicted 1963
8 SASI_Rn02_00315283 predicted 11535
9 SASI_Rn02_00315284 predicted 11108
10 SASI_Rn02_00315285 predicted 11480
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166460 predicted 3364
2 SASI_Rn01_00166461 predicted 13012
3 SASI_Rn01_00166462 predicted 6636
4 SASI_Rn01_00166463 predicted 10268
5 SASI_Rn01_00166464 predicted 2921
6 SASI_Rn01_00166465 predicted 9847
7 SASI_Rn01_00166466 predicted 5233
8 SASI_Rn01_00166467 predicted 10385
9 SASI_Rn01_00166468 predicted 10936
10 SASI_Rn01_00166469 predicted 6821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026375 predicted 14265
2 SASI_Mm01_00026376 predicted 6794
3 SASI_Mm01_00026377 predicted 7943
4 SASI_Mm01_00026378 predicted 12840
5 SASI_Mm02_00326042 predicted 10620
6 SASI_Mm01_00026379 predicted 11734
7 SASI_Mm01_00026380 predicted 4169
8 SASI_Mm01_00026381 predicted 5022
9 SASI_Mm02_00326043 predicted 10429
10 SASI_Mm01_00026384 predicted 8713
11 SASI_Mm01_00026382 predicted 9317
12 SASI_Mm01_00026383 predicted 14089
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007123
USH2A MISSION shRNA Bacterial Glycerol Stock
Usher syndrome 2A (autosomal recessive, mild)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007123.4-5601s1c1
Sequence:CCGGGCCAGGACTATGGTAAAGCAACTCGAGTTGCTTTACCATAGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007123.4-3633s1c1
Sequence:CCGGCCACTGGCTTACTTACAGTTTCTCGAGAAACTGTAAGTAAGCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007123.4-1831s1c1
Sequence:CCGGGCCACGCAAATAAGGTTTCATCTCGAGATGAAACCTTATTTGCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007123.4-1222s1c1
Sequence:CCGGGCACTTACAAACAGAGAGATTCTCGAGAATCTCTCTGTTTGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007123.4-4116s1c1
Sequence:CCGGCCAAAGACTAAGTCCACCTAACTCGAGTTAGGTGGACTTAGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007123.5-1772s21c1
Sequence:CCGGATTATCGTCCTGGATACAATACTCGAGTATTGTATCCAGGACGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007123.5-1482s21c1
Sequence:CCGGTAATCAAGGAGTGACTATTTCCTCGAGGAAATAGTCACTCCTTGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007123.5-1559s21c1
Sequence:CCGGGTCCACAACCAACGGAAATAACTCGAGTTATTTCCGTTGGTTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007123
USH2A MISSION shRNA shRNA Plasmid DNA
Usher syndrome 2A (autosomal recessive, mild)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007123.4-5601s1c1
Sequence:CCGGGCCAGGACTATGGTAAAGCAACTCGAGTTGCTTTACCATAGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007123.4-3633s1c1
Sequence:CCGGCCACTGGCTTACTTACAGTTTCTCGAGAAACTGTAAGTAAGCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007123.4-1831s1c1
Sequence:CCGGGCCACGCAAATAAGGTTTCATCTCGAGATGAAACCTTATTTGCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007123.4-1222s1c1
Sequence:CCGGGCACTTACAAACAGAGAGATTCTCGAGAATCTCTCTGTTTGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007123.4-4116s1c1
Sequence:CCGGCCAAAGACTAAGTCCACCTAACTCGAGTTAGGTGGACTTAGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007123.5-1772s21c1
Sequence:CCGGATTATCGTCCTGGATACAATACTCGAGTATTGTATCCAGGACGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007123.5-1482s21c1
Sequence:CCGGTAATCAAGGAGTGACTATTTCCTCGAGGAAATAGTCACTCCTTGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007123.5-1559s21c1
Sequence:CCGGGTCCACAACCAACGGAAATAACTCGAGTTATTTCCGTTGGTTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007123
USH2A MISSION shRNA Lentiviral Transduction Particles
Usher syndrome 2A (autosomal recessive, mild)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007123.4-5601s1c1
Sequence:CCGGGCCAGGACTATGGTAAAGCAACTCGAGTTGCTTTACCATAGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007123.4-3633s1c1
Sequence:CCGGCCACTGGCTTACTTACAGTTTCTCGAGAAACTGTAAGTAAGCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007123.4-1831s1c1
Sequence:CCGGGCCACGCAAATAAGGTTTCATCTCGAGATGAAACCTTATTTGCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007123.4-1222s1c1
Sequence:CCGGGCACTTACAAACAGAGAGATTCTCGAGAATCTCTCTGTTTGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007123.4-4116s1c1
Sequence:CCGGCCAAAGACTAAGTCCACCTAACTCGAGTTAGGTGGACTTAGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007123.5-1772s21c1
Sequence:CCGGATTATCGTCCTGGATACAATACTCGAGTATTGTATCCAGGACGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007123.5-1482s21c1
Sequence:CCGGTAATCAAGGAGTGACTATTTCCTCGAGGAAATAGTCACTCCTTGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007123.5-1559s21c1
Sequence:CCGGGTCCACAACCAACGGAAATAACTCGAGTTATTTCCGTTGGTTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021408
USH2A MISSION shRNA Bacterial Glycerol Stock
Usher syndrome 2A (autosomal recessive, mild)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021408.3-6506s21c1
Sequence:CCGGTTCGCAGCCTACGAGATTATACTCGAGTATAATCTCGTAGGCTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021408.3-10757s21c1
Sequence:CCGGGGTCCTATCATTCACTATATTCTCGAGAATATAGTGAATGATAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021408.3-8849s21c1
Sequence:CCGGAGGTTCACAACGTACGAATATCTCGAGATATTCGTACGTTGTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021408.3-3986s21c1
Sequence:CCGGGTGGACTCAAATGGTATAATTCTCGAGAATTATACCATTTGAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021408.3-2368s21c1
Sequence:CCGGTCGCTGCAATTTCGGATTTAACTCGAGTTAAATCCGAAATTGCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021408
USH2A MISSION shRNA shRNA Plasmid DNA
Usher syndrome 2A (autosomal recessive, mild)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021408.3-6506s21c1
Sequence:CCGGTTCGCAGCCTACGAGATTATACTCGAGTATAATCTCGTAGGCTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021408.3-10757s21c1
Sequence:CCGGGGTCCTATCATTCACTATATTCTCGAGAATATAGTGAATGATAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021408.3-8849s21c1
Sequence:CCGGAGGTTCACAACGTACGAATATCTCGAGATATTCGTACGTTGTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021408.3-3986s21c1
Sequence:CCGGGTGGACTCAAATGGTATAATTCTCGAGAATTATACCATTTGAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021408.3-2368s21c1
Sequence:CCGGTCGCTGCAATTTCGGATTTAACTCGAGTTAAATCCGAAATTGCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021408
USH2A MISSION shRNA Lentiviral Transduction Particles
Usher syndrome 2A (autosomal recessive, mild)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021408.3-6506s21c1
Sequence:CCGGTTCGCAGCCTACGAGATTATACTCGAGTATAATCTCGTAGGCTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021408.3-10757s21c1
Sequence:CCGGGGTCCTATCATTCACTATATTCTCGAGAATATAGTGAATGATAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021408.3-8849s21c1
Sequence:CCGGAGGTTCACAACGTACGAATATCTCGAGATATTCGTACGTTGTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021408.3-3986s21c1
Sequence:CCGGGTGGACTCAAATGGTATAATTCTCGAGAATTATACCATTTGAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021408.3-2368s21c1
Sequence:CCGGTCGCTGCAATTTCGGATTTAACTCGAGTTAAATCCGAAATTGCAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks