EMAIL THIS PAGE TO A FRIEND

USHBP1

Usher syndrome 1C binding protein 1

Synonyms: AIEBP MCC2
UniProtKB ID: Q8N6Y0, Q8NBX7, Q96KH3, Q9BYI8
Gene ID:
Mouse(234395) Usher syndrome 1C binding protein 1
Rat(290629) Usher syndrome 1C binding protein 1
chicken(427088) Usher syndrome 1C binding protein 1
dog(484842) Usher syndrome 1C binding protein 1
domestic cat(101095801) Usher syndrome 1C binding protein 1
Horse(100070053) Usher syndrome 1C binding protein 1
naked mole-rat(101723727) Usher syndrome 1C binding protein 1
domestic guinea pig(100731631) Usher syndrome 1C binding protein 1
cow(768083) Usher syndrome 1C binding protein 1
sheep(101113408) Usher syndrome 1C binding protein 1
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031941 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031941 Rosetta Predictions human pricing
NM_001033687 Rosetta Predictions rat pricing
NM_181418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061901 predicted 1172
2 SASI_Hs01_00061903 predicted 1997
3 SASI_Hs01_00061904 predicted 1024
4 SASI_Hs01_00061905 predicted 1387
5 SASI_Hs01_00061906 predicted 1062
6 SASI_Hs01_00061907 predicted 2006
7 SASI_Hs01_00061908 predicted 1053
8 SASI_Hs02_00359087 predicted 1143
9 SASI_Hs01_00061909 predicted 1893
10 SASI_Hs02_00359088 predicted 402
11 SASI_Hs01_00061900 predicted 1024
12 SASI_Hs01_00061902 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033687 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088332 predicted 344
2 SASI_Rn01_00088333 predicted 1099
3 SASI_Rn01_00088334 predicted 475
4 SASI_Rn01_00088335 predicted 1080
5 SASI_Rn01_00088336 predicted 1301
6 SASI_Rn01_00088337 predicted 1968
7 SASI_Rn01_00088338 predicted 1116
8 SASI_Rn01_00088339 predicted 1331
9 SASI_Rn01_00088340 predicted 334
10 SASI_Rn01_00088341 predicted 2210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349775 predicted 2213
2 SASI_Mm01_00096307 predicted 1865
3 SASI_Mm01_00096308 predicted 478
4 SASI_Mm01_00096309 predicted 1080
5 SASI_Mm01_00096310 predicted 367
6 SASI_Mm01_00096311 predicted 837
7 SASI_Mm02_00349776 predicted 2289
8 SASI_Mm02_00349777 predicted 2300
9 SASI_Mm01_00096312 predicted 337
10 SASI_Mm01_00096314 predicted 1630
11 SASI_Mm01_00096313 predicted 2199
12 SASI_Mm01_00096315 predicted 439
13 SASI_Mm01_00096316 predicted 1485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031941
USHBP1 MISSION shRNA Bacterial Glycerol Stock
Usher syndrome 1C binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031941.3-1417s21c1
Sequence:CCGGGCCGTTCTCTAATGAAGATTCCTCGAGGAATCTTCATTAGAGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031941.3-2232s21c1
Sequence:CCGGTACCCAGCCATGTCTGGACATCTCGAGATGTCCAGACATGGCTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031941.3-1058s21c1
Sequence:CCGGAGCTGTGCTACAGGGATACAACTCGAGTTGTATCCCTGTAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031941.3-1337s21c1
Sequence:CCGGTGAAGGCAGCAGTGTGGATAACTCGAGTTATCCACACTGCTGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031941.3-741s21c1
Sequence:CCGGACGCTGCAGAAAGAGGTTCAACTCGAGTTGAACCTCTTTCTGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172363    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031941.2-2283s1c1
Sequence:CCGGCCTGGAGTGACATCATGTCATCTCGAGATGACATGATGTCACTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031941.2-2002s1c1
Sequence:CCGGCCGAGCTGAACAGGGATTTATCTCGAGATAAATCCCTGTTCAGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031941.2-1547s1c1
Sequence:CCGGGAAGACACAAATTCAGCAGGACTCGAGTCCTGCTGAATTTGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031941.2-1026s1c1
Sequence:CCGGGAGAAGCTCAAATGCTTTAATCTCGAGATTAAAGCATTTGAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031941.2-1031s1c1
Sequence:CCGGGCTCAAATGCTTTAATCGTCTCTCGAGAGACGATTAAAGCATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031941
USHBP1 MISSION shRNA shRNA Plasmid DNA
Usher syndrome 1C binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031941.3-1417s21c1
Sequence:CCGGGCCGTTCTCTAATGAAGATTCCTCGAGGAATCTTCATTAGAGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031941.3-2232s21c1
Sequence:CCGGTACCCAGCCATGTCTGGACATCTCGAGATGTCCAGACATGGCTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031941.3-1058s21c1
Sequence:CCGGAGCTGTGCTACAGGGATACAACTCGAGTTGTATCCCTGTAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031941.3-1337s21c1
Sequence:CCGGTGAAGGCAGCAGTGTGGATAACTCGAGTTATCCACACTGCTGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031941.3-741s21c1
Sequence:CCGGACGCTGCAGAAAGAGGTTCAACTCGAGTTGAACCTCTTTCTGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172363    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031941.2-2283s1c1
Sequence:CCGGCCTGGAGTGACATCATGTCATCTCGAGATGACATGATGTCACTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031941.2-2002s1c1
Sequence:CCGGCCGAGCTGAACAGGGATTTATCTCGAGATAAATCCCTGTTCAGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031941.2-1547s1c1
Sequence:CCGGGAAGACACAAATTCAGCAGGACTCGAGTCCTGCTGAATTTGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031941.2-1026s1c1
Sequence:CCGGGAGAAGCTCAAATGCTTTAATCTCGAGATTAAAGCATTTGAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031941.2-1031s1c1
Sequence:CCGGGCTCAAATGCTTTAATCGTCTCTCGAGAGACGATTAAAGCATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031941
USHBP1 MISSION shRNA Lentiviral Transduction Particles
Usher syndrome 1C binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031941.3-1417s21c1
Sequence:CCGGGCCGTTCTCTAATGAAGATTCCTCGAGGAATCTTCATTAGAGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031941.3-2232s21c1
Sequence:CCGGTACCCAGCCATGTCTGGACATCTCGAGATGTCCAGACATGGCTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031941.3-1058s21c1
Sequence:CCGGAGCTGTGCTACAGGGATACAACTCGAGTTGTATCCCTGTAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031941.3-1337s21c1
Sequence:CCGGTGAAGGCAGCAGTGTGGATAACTCGAGTTATCCACACTGCTGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031941.3-741s21c1
Sequence:CCGGACGCTGCAGAAAGAGGTTCAACTCGAGTTGAACCTCTTTCTGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172363    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031941.2-2283s1c1
Sequence:CCGGCCTGGAGTGACATCATGTCATCTCGAGATGACATGATGTCACTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031941.2-2002s1c1
Sequence:CCGGCCGAGCTGAACAGGGATTTATCTCGAGATAAATCCCTGTTCAGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031941.2-1547s1c1
Sequence:CCGGGAAGACACAAATTCAGCAGGACTCGAGTCCTGCTGAATTTGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031941.2-1026s1c1
Sequence:CCGGGAGAAGCTCAAATGCTTTAATCTCGAGATTAAAGCATTTGAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031941.2-1031s1c1
Sequence:CCGGGCTCAAATGCTTTAATCGTCTCTCGAGAGACGATTAAAGCATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181418
USHBP1 MISSION shRNA Bacterial Glycerol Stock
Usher syndrome 1C binding protein 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181418.2-263s1c1
Sequence:CCGGGAGACTAAACCTGAGCTGCATCTCGAGATGCAGCTCAGGTTTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181418.2-362s1c1
Sequence:CCGGCTATCCTTGAGCCCAGAAGAACTCGAGTTCTTCTGGGCTCAAGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181418.2-451s1c1
Sequence:CCGGGATATCAGTACCCAGTGTGTACTCGAGTACACACTGGGTACTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181418.2-1023s1c1
Sequence:CCGGGCATTGAGAAATTGAAGTGCTCTCGAGAGCACTTCAATTTCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181418.2-250s1c1
Sequence:CCGGCAATGGATGCTTCGAGACTAACTCGAGTTAGTCTCGAAGCATCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181418.2-1153s1c1
Sequence:CCGGGCAGTATAGTGAGGACTGTGACTCGAGTCACAGTCCTCACTATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181418
USHBP1 MISSION shRNA shRNA Plasmid DNA
Usher syndrome 1C binding protein 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181418.2-263s1c1
Sequence:CCGGGAGACTAAACCTGAGCTGCATCTCGAGATGCAGCTCAGGTTTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181418.2-362s1c1
Sequence:CCGGCTATCCTTGAGCCCAGAAGAACTCGAGTTCTTCTGGGCTCAAGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181418.2-451s1c1
Sequence:CCGGGATATCAGTACCCAGTGTGTACTCGAGTACACACTGGGTACTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181418.2-1023s1c1
Sequence:CCGGGCATTGAGAAATTGAAGTGCTCTCGAGAGCACTTCAATTTCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181418.2-250s1c1
Sequence:CCGGCAATGGATGCTTCGAGACTAACTCGAGTTAGTCTCGAAGCATCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181418.2-1153s1c1
Sequence:CCGGGCAGTATAGTGAGGACTGTGACTCGAGTCACAGTCCTCACTATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181418
USHBP1 MISSION shRNA Lentiviral Transduction Particles
Usher syndrome 1C binding protein 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181418.2-263s1c1
Sequence:CCGGGAGACTAAACCTGAGCTGCATCTCGAGATGCAGCTCAGGTTTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181418.2-362s1c1
Sequence:CCGGCTATCCTTGAGCCCAGAAGAACTCGAGTTCTTCTGGGCTCAAGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181418.2-451s1c1
Sequence:CCGGGATATCAGTACCCAGTGTGTACTCGAGTACACACTGGGTACTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181418.2-1023s1c1
Sequence:CCGGGCATTGAGAAATTGAAGTGCTCTCGAGAGCACTTCAATTTCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181418.2-250s1c1
Sequence:CCGGCAATGGATGCTTCGAGACTAACTCGAGTTAGTCTCGAAGCATCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181418.2-1153s1c1
Sequence:CCGGGCAGTATAGTGAGGACTGTGACTCGAGTCACAGTCCTCACTATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks