EMAIL THIS PAGE TO A FRIEND

USMG5

up-regulated during skeletal muscle growth 5 homolog (mouse)

Synonyms: DAPIT HCVFTP2 bA792D24.4
UniProtKB ID: Q96IX5, B2R4N2, D3DR92
Gene ID:
Mouse(66477) upregulated during skeletal muscle growth 5
Rat(171069) up-regulated during skeletal muscle growth 5 homolog (mouse)
cow(767982) up-regulated during skeletal muscle growth 5 homolog (mouse)
sheep(101111410) up-regulated during skeletal muscle growth 5 homolog (mouse)
domestic guinea pig(100724679) up-regulated during skeletal muscle growth 5 homolog (mouse)
naked mole-rat(101703467) up-regulated during skeletal muscle growth 5 homolog (mouse)
chicken(423873) up-regulated during skeletal muscle growth 5 homolog (mouse)
domestic cat(101086849) up-regulated during skeletal muscle growth 5 homolog (mouse)
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2106891 Anti-USMG5 antibody produced in rabbit affinity isolated antibody rabbit, human, guinea pig
ELISA, western blot pricing
HPA044798 Anti-USMG5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032747 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032747 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032747 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023211 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023211 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023211 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103831 MISSION® esiRNA esiRNA human USMG5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032747 Rosetta Predictions human pricing
NM_133544 Rosetta Predictions rat pricing
NM_023211 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131417 predicted 313
2 SASI_Hs01_00131418 predicted 273
3 SASI_Hs01_00131420 predicted 285
4 SASI_Hs01_00131421 predicted 321
5 SASI_Hs01_00131422 predicted 287
6 SASI_Hs01_00131423 predicted 321
7 SASI_Hs01_00131424 predicted 282
8 SASI_Hs01_00131425 predicted 271
9 SASI_Hs01_00131426 predicted 283
10 SASI_Hs02_00360297 predicted 327
11 SASI_Hs01_00131419 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045369 predicted 43
2 SASI_Rn01_00045371 predicted 144
3 SASI_Rn01_00045372 predicted 178
4 SASI_Rn01_00045373 predicted 41
5 SASI_Rn02_00267731 predicted 134
6 SASI_Rn01_00045374 predicted 264
7 SASI_Rn01_00045375 predicted 118
8 SASI_Rn01_00045376 predicted 78
9 SASI_Rn01_00045377 predicted 183
10 SASI_Rn01_00045378 predicted 146
11 SASI_Rn01_00045370 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023211 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157857 predicted 178
2 SASI_Mm01_00157858 predicted 215
3 SASI_Mm01_00157859 predicted 85
4 SASI_Mm01_00157860 predicted 168
5 SASI_Mm01_00157861 predicted 79
6 SASI_Mm01_00157863 predicted 183
7 SASI_Mm01_00157864 predicted 167
8 SASI_Mm02_00326955 predicted 195
9 SASI_Mm02_00326956 predicted 219
10 SASI_Mm01_00157866 predicted 155
11 SASI_Mm01_00157862 predicted 301
12 SASI_Mm01_00157865 predicted 301
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032747
VALIDATED
USMG5 MISSION shRNA Bacterial Glycerol Stock
up-regulated during skeletal muscle growth 5 homolog (mouse)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032747.1-343s1c1
Sequence:CCGGGAATGAACTGTGTACTGGCCACTCGAGTGGCCAGTACACAGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032747.1-373s1c1
Sequence:CCGGGCATTGCATTGATTGTCTTATCTCGAGATAAGACAATCAATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032747.1-325s1c1
Sequence:CCGGCTTATACTCTCACAGGTAGAACTCGAGTTCTACCTGTGAGAGTATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032747.1-335s1c1
Sequence:CCGGCACAGGTAGAATGAACTGTGTCTCGAGACACAGTTCATTCTACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032747.1-370s1c1
Sequence:CCGGGAAGCATTGCATTGATTGTCTCTCGAGAGACAATCAATGCAATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032747
VALIDATED
USMG5 MISSION shRNA shRNA Plasmid DNA
up-regulated during skeletal muscle growth 5 homolog (mouse)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032747.1-343s1c1
Sequence:CCGGGAATGAACTGTGTACTGGCCACTCGAGTGGCCAGTACACAGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032747.1-373s1c1
Sequence:CCGGGCATTGCATTGATTGTCTTATCTCGAGATAAGACAATCAATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032747.1-325s1c1
Sequence:CCGGCTTATACTCTCACAGGTAGAACTCGAGTTCTACCTGTGAGAGTATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032747.1-335s1c1
Sequence:CCGGCACAGGTAGAATGAACTGTGTCTCGAGACACAGTTCATTCTACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032747.1-370s1c1
Sequence:CCGGGAAGCATTGCATTGATTGTCTCTCGAGAGACAATCAATGCAATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032747
VALIDATED
USMG5 MISSION shRNA Lentiviral Transduction Particles
up-regulated during skeletal muscle growth 5 homolog (mouse)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032747.1-343s1c1
Sequence:CCGGGAATGAACTGTGTACTGGCCACTCGAGTGGCCAGTACACAGTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032747.1-373s1c1
Sequence:CCGGGCATTGCATTGATTGTCTTATCTCGAGATAAGACAATCAATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032747.1-325s1c1
Sequence:CCGGCTTATACTCTCACAGGTAGAACTCGAGTTCTACCTGTGAGAGTATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032747.1-335s1c1
Sequence:CCGGCACAGGTAGAATGAACTGTGTCTCGAGACACAGTTCATTCTACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032747.1-370s1c1
Sequence:CCGGGAAGCATTGCATTGATTGTCTCTCGAGAGACAATCAATGCAATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023211
VALIDATED
USMG5 MISSION shRNA Bacterial Glycerol Stock
up-regulated during skeletal muscle growth 5 homolog (mouse)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_023211.2-223s1c1
Sequence:CCGGGAATGAATTGTGTCCTGGCCACTCGAGTGGCCAGGACACAATTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_023211.2-215s1c1
Sequence:CCGGCACAGGTAGAATGAATTGTGTCTCGAGACACAATTCATTCTACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_023211.1-180s1c1
Sequence:CCGGGCATTGCTTTGCTGGTCTTATCTCGAGATAAGACCAGCAAAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023211.4-146s21c1
Sequence:CCGGGAATTGTGTCCTGGCCACATACTCGAGTATGTGGCCAGGACACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023211.4-194s21c1
Sequence:CCGGCTTCAAGTTAAGGCCTAAGAACTCGAGTTCTTAGGCCTTAACTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023211.4-118s21c1
Sequence:CCGGTCAACTCTTATACCCTCACAGCTCGAGCTGTGAGGGTATAAGAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023211.4-89s21c1
Sequence:CCGGATTCCAGTTCACTGGTATTAACTCGAGTTAATACCAGTGAACTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023211.4-183s1c1
Sequence:CCGGCTGGTCTTATACTTCAAGTTACTCGAGTAACTTGAAGTATAAGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023211.4-71s21c1
Sequence:CCGGTGCAGAAAGTGATGGCCAATTCTCGAGAATTGGCCATCACTTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023211
VALIDATED
USMG5 MISSION shRNA shRNA Plasmid DNA
up-regulated during skeletal muscle growth 5 homolog (mouse)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_023211.2-223s1c1
Sequence:CCGGGAATGAATTGTGTCCTGGCCACTCGAGTGGCCAGGACACAATTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_023211.2-215s1c1
Sequence:CCGGCACAGGTAGAATGAATTGTGTCTCGAGACACAATTCATTCTACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_023211.1-180s1c1
Sequence:CCGGGCATTGCTTTGCTGGTCTTATCTCGAGATAAGACCAGCAAAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023211.4-146s21c1
Sequence:CCGGGAATTGTGTCCTGGCCACATACTCGAGTATGTGGCCAGGACACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023211.4-194s21c1
Sequence:CCGGCTTCAAGTTAAGGCCTAAGAACTCGAGTTCTTAGGCCTTAACTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023211.4-118s21c1
Sequence:CCGGTCAACTCTTATACCCTCACAGCTCGAGCTGTGAGGGTATAAGAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023211.4-89s21c1
Sequence:CCGGATTCCAGTTCACTGGTATTAACTCGAGTTAATACCAGTGAACTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023211.4-183s1c1
Sequence:CCGGCTGGTCTTATACTTCAAGTTACTCGAGTAACTTGAAGTATAAGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023211.4-71s21c1
Sequence:CCGGTGCAGAAAGTGATGGCCAATTCTCGAGAATTGGCCATCACTTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023211
VALIDATED
USMG5 MISSION shRNA Lentiviral Transduction Particles
up-regulated during skeletal muscle growth 5 homolog (mouse)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_023211.2-223s1c1
Sequence:CCGGGAATGAATTGTGTCCTGGCCACTCGAGTGGCCAGGACACAATTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_023211.2-215s1c1
Sequence:CCGGCACAGGTAGAATGAATTGTGTCTCGAGACACAATTCATTCTACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_023211.1-180s1c1
Sequence:CCGGGCATTGCTTTGCTGGTCTTATCTCGAGATAAGACCAGCAAAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023211.4-146s21c1
Sequence:CCGGGAATTGTGTCCTGGCCACATACTCGAGTATGTGGCCAGGACACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023211.4-194s21c1
Sequence:CCGGCTTCAAGTTAAGGCCTAAGAACTCGAGTTCTTAGGCCTTAACTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023211.4-118s21c1
Sequence:CCGGTCAACTCTTATACCCTCACAGCTCGAGCTGTGAGGGTATAAGAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023211.4-89s21c1
Sequence:CCGGATTCCAGTTCACTGGTATTAACTCGAGTTAATACCAGTGAACTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023211.4-183s1c1
Sequence:CCGGCTGGTCTTATACTTCAAGTTACTCGAGTAACTTGAAGTATAAGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023211.4-71s21c1
Sequence:CCGGTGCAGAAAGTGATGGCCAATTCTCGAGAATTGGCCATCACTTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks